ID: 1069980336

View in Genome Browser
Species Human (GRCh38)
Location 10:72248027-72248049
Sequence GCACAATCCCAGCCAACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069980336_1069980339 -9 Left 1069980336 10:72248027-72248049 CCAGAAGTTGGCTGGGATTGTGC No data
Right 1069980339 10:72248041-72248063 GGATTGTGCTGGGTTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069980336 Original CRISPR GCACAATCCCAGCCAACTTC TGG (reversed) Intergenic
No off target data available for this crispr