ID: 1069982082

View in Genome Browser
Species Human (GRCh38)
Location 10:72259933-72259955
Sequence TTTCCTGCATAGATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069982082_1069982086 -9 Left 1069982082 10:72259933-72259955 CCTTGCTCCATCTATGCAGGAAA No data
Right 1069982086 10:72259947-72259969 TGCAGGAAAGCCATAGTGTGGGG No data
1069982082_1069982090 29 Left 1069982082 10:72259933-72259955 CCTTGCTCCATCTATGCAGGAAA No data
Right 1069982090 10:72259985-72260007 GTCAGCCTCTGCAAGCAACAAGG No data
1069982082_1069982089 5 Left 1069982082 10:72259933-72259955 CCTTGCTCCATCTATGCAGGAAA No data
Right 1069982089 10:72259961-72259983 AGTGTGGGGCTGTAGGACTATGG No data
1069982082_1069982085 -10 Left 1069982082 10:72259933-72259955 CCTTGCTCCATCTATGCAGGAAA No data
Right 1069982085 10:72259946-72259968 ATGCAGGAAAGCCATAGTGTGGG No data
1069982082_1069982087 -2 Left 1069982082 10:72259933-72259955 CCTTGCTCCATCTATGCAGGAAA No data
Right 1069982087 10:72259954-72259976 AAGCCATAGTGTGGGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069982082 Original CRISPR TTTCCTGCATAGATGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr