ID: 1069982404

View in Genome Browser
Species Human (GRCh38)
Location 10:72261401-72261423
Sequence GAATTGCTGCCTGTGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069982404_1069982409 -2 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982409 10:72261422-72261444 TCCCAGAGTGGCCTTCCTATGGG No data
1069982404_1069982408 -3 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982408 10:72261421-72261443 TTCCCAGAGTGGCCTTCCTATGG No data
1069982404_1069982415 16 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982415 10:72261440-72261462 ATGGGACCCCAGAGCTCCCAGGG No data
1069982404_1069982414 15 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982414 10:72261439-72261461 TATGGGACCCCAGAGCTCCCAGG No data
1069982404_1069982418 21 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982418 10:72261445-72261467 ACCCCAGAGCTCCCAGGGGGAGG No data
1069982404_1069982416 17 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982416 10:72261441-72261463 TGGGACCCCAGAGCTCCCAGGGG No data
1069982404_1069982417 18 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982417 10:72261442-72261464 GGGACCCCAGAGCTCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069982404 Original CRISPR GAATTGCTGCCTGTGAAGAG GGG (reversed) Intergenic
No off target data available for this crispr