ID: 1069982408

View in Genome Browser
Species Human (GRCh38)
Location 10:72261421-72261443
Sequence TTCCCAGAGTGGCCTTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069982406_1069982408 -5 Left 1069982406 10:72261403-72261425 CCTCTTCACAGGCAGCAATTCCC No data
Right 1069982408 10:72261421-72261443 TTCCCAGAGTGGCCTTCCTATGG No data
1069982405_1069982408 -4 Left 1069982405 10:72261402-72261424 CCCTCTTCACAGGCAGCAATTCC No data
Right 1069982408 10:72261421-72261443 TTCCCAGAGTGGCCTTCCTATGG No data
1069982404_1069982408 -3 Left 1069982404 10:72261401-72261423 CCCCTCTTCACAGGCAGCAATTC No data
Right 1069982408 10:72261421-72261443 TTCCCAGAGTGGCCTTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069982408 Original CRISPR TTCCCAGAGTGGCCTTCCTA TGG Intergenic
No off target data available for this crispr