ID: 1069984325

View in Genome Browser
Species Human (GRCh38)
Location 10:72273439-72273461
Sequence TGCCCGTGGGACGGCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069984325_1069984341 30 Left 1069984325 10:72273439-72273461 CCTGCGCCGCCGTCCCACGGGCA No data
Right 1069984341 10:72273492-72273514 AGCTTTAGGATCCAAGACGCTGG No data
1069984325_1069984338 16 Left 1069984325 10:72273439-72273461 CCTGCGCCGCCGTCCCACGGGCA No data
Right 1069984338 10:72273478-72273500 CCAGTTGTTCCCGAAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069984325 Original CRISPR TGCCCGTGGGACGGCGGCGC AGG (reversed) Intergenic