ID: 1069985567

View in Genome Browser
Species Human (GRCh38)
Location 10:72280639-72280661
Sequence TTCTCAGCTGGGCCCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069985567_1069985570 2 Left 1069985567 10:72280639-72280661 CCATGCAGGGGCCCAGCTGAGAA No data
Right 1069985570 10:72280664-72280686 TTCCATCTTGATCCCAGCCATGG No data
1069985567_1069985578 25 Left 1069985567 10:72280639-72280661 CCATGCAGGGGCCCAGCTGAGAA No data
Right 1069985578 10:72280687-72280709 GCAGCTTCATGGAAACTTCTGGG No data
1069985567_1069985571 3 Left 1069985567 10:72280639-72280661 CCATGCAGGGGCCCAGCTGAGAA No data
Right 1069985571 10:72280665-72280687 TCCATCTTGATCCCAGCCATGGG No data
1069985567_1069985579 26 Left 1069985567 10:72280639-72280661 CCATGCAGGGGCCCAGCTGAGAA No data
Right 1069985579 10:72280688-72280710 CAGCTTCATGGAAACTTCTGGGG No data
1069985567_1069985577 24 Left 1069985567 10:72280639-72280661 CCATGCAGGGGCCCAGCTGAGAA No data
Right 1069985577 10:72280686-72280708 GGCAGCTTCATGGAAACTTCTGG No data
1069985567_1069985574 14 Left 1069985567 10:72280639-72280661 CCATGCAGGGGCCCAGCTGAGAA No data
Right 1069985574 10:72280676-72280698 CCCAGCCATGGGCAGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069985567 Original CRISPR TTCTCAGCTGGGCCCCTGCA TGG (reversed) Intergenic
No off target data available for this crispr