ID: 1069987326

View in Genome Browser
Species Human (GRCh38)
Location 10:72293308-72293330
Sequence AAGAGGAAGCAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069987326_1069987336 0 Left 1069987326 10:72293308-72293330 CCCTCCCCATTCTGCTTCCTCTT No data
Right 1069987336 10:72293331-72293353 TGAGGTGGCCTGGCTCCTGGTGG No data
1069987326_1069987335 -3 Left 1069987326 10:72293308-72293330 CCCTCCCCATTCTGCTTCCTCTT No data
Right 1069987335 10:72293328-72293350 CTTTGAGGTGGCCTGGCTCCTGG No data
1069987326_1069987340 30 Left 1069987326 10:72293308-72293330 CCCTCCCCATTCTGCTTCCTCTT No data
Right 1069987340 10:72293361-72293383 GTGCTAGAAGACAGCAGAGATGG No data
1069987326_1069987333 -10 Left 1069987326 10:72293308-72293330 CCCTCCCCATTCTGCTTCCTCTT No data
Right 1069987333 10:72293321-72293343 GCTTCCTCTTTGAGGTGGCCTGG No data
1069987326_1069987337 4 Left 1069987326 10:72293308-72293330 CCCTCCCCATTCTGCTTCCTCTT No data
Right 1069987337 10:72293335-72293357 GTGGCCTGGCTCCTGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069987326 Original CRISPR AAGAGGAAGCAGAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr