ID: 1069987726

View in Genome Browser
Species Human (GRCh38)
Location 10:72295766-72295788
Sequence CTGTAGTACAAGGTGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069987719_1069987726 -9 Left 1069987719 10:72295752-72295774 CCCCTGACTGGCACCTGTAGTAC No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987711_1069987726 25 Left 1069987711 10:72295718-72295740 CCCAGGGCAAGACCCTCACTTTC No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987712_1069987726 24 Left 1069987712 10:72295719-72295741 CCAGGGCAAGACCCTCACTTTCC No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987717_1069987726 -2 Left 1069987717 10:72295745-72295767 CCGTTTCCCCCTGACTGGCACCT No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987718_1069987726 -8 Left 1069987718 10:72295751-72295773 CCCCCTGACTGGCACCTGTAGTA No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987720_1069987726 -10 Left 1069987720 10:72295753-72295775 CCCTGACTGGCACCTGTAGTACA No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987715_1069987726 3 Left 1069987715 10:72295740-72295762 CCAATCCGTTTCCCCCTGACTGG No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987714_1069987726 12 Left 1069987714 10:72295731-72295753 CCTCACTTTCCAATCCGTTTCCC No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data
1069987713_1069987726 13 Left 1069987713 10:72295730-72295752 CCCTCACTTTCCAATCCGTTTCC No data
Right 1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069987726 Original CRISPR CTGTAGTACAAGGTGCAGAG GGG Intergenic
No off target data available for this crispr