ID: 1069988139

View in Genome Browser
Species Human (GRCh38)
Location 10:72297992-72298014
Sequence GGGTCGGGGTCACGCTCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069988139_1069988157 27 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988139_1069988154 15 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988154 10:72298030-72298052 CCCGTAGGATCGCGGGCGCGCGG No data
1069988139_1069988149 0 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988149 10:72298015-72298037 AGGGCCACGGCTGCGCCCGTAGG No data
1069988139_1069988156 16 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988156 10:72298031-72298053 CCGTAGGATCGCGGGCGCGCGGG No data
1069988139_1069988158 28 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988158 10:72298043-72298065 GGGCGCGCGGGTCTCCATGAGGG No data
1069988139_1069988152 8 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988152 10:72298023-72298045 GGCTGCGCCCGTAGGATCGCGGG No data
1069988139_1069988151 7 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988151 10:72298022-72298044 CGGCTGCGCCCGTAGGATCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069988139 Original CRISPR GGGTCGGGGTCACGCTCGCT GGG (reversed) Intergenic