ID: 1069988146

View in Genome Browser
Species Human (GRCh38)
Location 10:72298008-72298030
Sequence GCGCAGCCGTGGCCCTGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069988146_1069988159 17 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988159 10:72298048-72298070 CGCGGGTCTCCATGAGGGACTGG No data
1069988146_1069988158 12 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988158 10:72298043-72298065 GGGCGCGCGGGTCTCCATGAGGG No data
1069988146_1069988156 0 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988156 10:72298031-72298053 CCGTAGGATCGCGGGCGCGCGGG No data
1069988146_1069988157 11 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988146_1069988154 -1 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988154 10:72298030-72298052 CCCGTAGGATCGCGGGCGCGCGG No data
1069988146_1069988152 -8 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988152 10:72298023-72298045 GGCTGCGCCCGTAGGATCGCGGG No data
1069988146_1069988151 -9 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988151 10:72298022-72298044 CGGCTGCGCCCGTAGGATCGCGG No data
1069988146_1069988160 18 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988160 10:72298049-72298071 GCGGGTCTCCATGAGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069988146 Original CRISPR GCGCAGCCGTGGCCCTGGGT CGG (reversed) Intergenic