ID: 1069988148

View in Genome Browser
Species Human (GRCh38)
Location 10:72298013-72298035
Sequence TACGGGCGCAGCCGTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069988148_1069988157 6 Left 1069988148 10:72298013-72298035 CCAGGGCCACGGCTGCGCCCGTA No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988148_1069988158 7 Left 1069988148 10:72298013-72298035 CCAGGGCCACGGCTGCGCCCGTA No data
Right 1069988158 10:72298043-72298065 GGGCGCGCGGGTCTCCATGAGGG No data
1069988148_1069988160 13 Left 1069988148 10:72298013-72298035 CCAGGGCCACGGCTGCGCCCGTA No data
Right 1069988160 10:72298049-72298071 GCGGGTCTCCATGAGGGACTGGG No data
1069988148_1069988156 -5 Left 1069988148 10:72298013-72298035 CCAGGGCCACGGCTGCGCCCGTA No data
Right 1069988156 10:72298031-72298053 CCGTAGGATCGCGGGCGCGCGGG No data
1069988148_1069988159 12 Left 1069988148 10:72298013-72298035 CCAGGGCCACGGCTGCGCCCGTA No data
Right 1069988159 10:72298048-72298070 CGCGGGTCTCCATGAGGGACTGG No data
1069988148_1069988154 -6 Left 1069988148 10:72298013-72298035 CCAGGGCCACGGCTGCGCCCGTA No data
Right 1069988154 10:72298030-72298052 CCCGTAGGATCGCGGGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069988148 Original CRISPR TACGGGCGCAGCCGTGGCCC TGG (reversed) Intergenic