ID: 1069988150

View in Genome Browser
Species Human (GRCh38)
Location 10:72298019-72298041
Sequence CGATCCTACGGGCGCAGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069988150_1069988158 1 Left 1069988150 10:72298019-72298041 CCACGGCTGCGCCCGTAGGATCG No data
Right 1069988158 10:72298043-72298065 GGGCGCGCGGGTCTCCATGAGGG No data
1069988150_1069988157 0 Left 1069988150 10:72298019-72298041 CCACGGCTGCGCCCGTAGGATCG No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988150_1069988160 7 Left 1069988150 10:72298019-72298041 CCACGGCTGCGCCCGTAGGATCG No data
Right 1069988160 10:72298049-72298071 GCGGGTCTCCATGAGGGACTGGG No data
1069988150_1069988159 6 Left 1069988150 10:72298019-72298041 CCACGGCTGCGCCCGTAGGATCG No data
Right 1069988159 10:72298048-72298070 CGCGGGTCTCCATGAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069988150 Original CRISPR CGATCCTACGGGCGCAGCCG TGG (reversed) Intergenic