ID: 1069988150 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:72298019-72298041 |
| Sequence | CGATCCTACGGGCGCAGCCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069988150_1069988158 | 1 | Left | 1069988150 | 10:72298019-72298041 | CCACGGCTGCGCCCGTAGGATCG | No data | ||
| Right | 1069988158 | 10:72298043-72298065 | GGGCGCGCGGGTCTCCATGAGGG | No data | ||||
| 1069988150_1069988157 | 0 | Left | 1069988150 | 10:72298019-72298041 | CCACGGCTGCGCCCGTAGGATCG | No data | ||
| Right | 1069988157 | 10:72298042-72298064 | CGGGCGCGCGGGTCTCCATGAGG | No data | ||||
| 1069988150_1069988160 | 7 | Left | 1069988150 | 10:72298019-72298041 | CCACGGCTGCGCCCGTAGGATCG | No data | ||
| Right | 1069988160 | 10:72298049-72298071 | GCGGGTCTCCATGAGGGACTGGG | No data | ||||
| 1069988150_1069988159 | 6 | Left | 1069988150 | 10:72298019-72298041 | CCACGGCTGCGCCCGTAGGATCG | No data | ||
| Right | 1069988159 | 10:72298048-72298070 | CGCGGGTCTCCATGAGGGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069988150 | Original CRISPR | CGATCCTACGGGCGCAGCCG TGG (reversed) | Intergenic | ||