ID: 1069988157

View in Genome Browser
Species Human (GRCh38)
Location 10:72298042-72298064
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069988145_1069988157 12 Left 1069988145 10:72298007-72298029 CCCGACCCAGGGCCACGGCTGCG No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988148_1069988157 6 Left 1069988148 10:72298013-72298035 CCAGGGCCACGGCTGCGCCCGTA No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988146_1069988157 11 Left 1069988146 10:72298008-72298030 CCGACCCAGGGCCACGGCTGCGC No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988139_1069988157 27 Left 1069988139 10:72297992-72298014 CCCAGCGAGCGTGACCCCGACCC No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988150_1069988157 0 Left 1069988150 10:72298019-72298041 CCACGGCTGCGCCCGTAGGATCG No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988144_1069988157 13 Left 1069988144 10:72298006-72298028 CCCCGACCCAGGGCCACGGCTGC No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988147_1069988157 7 Left 1069988147 10:72298012-72298034 CCCAGGGCCACGGCTGCGCCCGT No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data
1069988140_1069988157 26 Left 1069988140 10:72297993-72298015 CCAGCGAGCGTGACCCCGACCCA No data
Right 1069988157 10:72298042-72298064 CGGGCGCGCGGGTCTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069988157 Original CRISPR CGGGCGCGCGGGTCTCCATG AGG Intergenic
No off target data available for this crispr