ID: 1069990167

View in Genome Browser
Species Human (GRCh38)
Location 10:72310332-72310354
Sequence CTGAATCAGCGGGAGCCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069990160_1069990167 22 Left 1069990160 10:72310287-72310309 CCATAGGGTCTGTGGTTAGGACA No data
Right 1069990167 10:72310332-72310354 CTGAATCAGCGGGAGCCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069990167 Original CRISPR CTGAATCAGCGGGAGCCTTG CGG Intergenic
No off target data available for this crispr