ID: 1069991826

View in Genome Browser
Species Human (GRCh38)
Location 10:72321009-72321031
Sequence TAACCCCAGCCGGTACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069991823_1069991826 12 Left 1069991823 10:72320974-72320996 CCCATCTGGCTGATGCAAGGCTT No data
Right 1069991826 10:72321009-72321031 TAACCCCAGCCGGTACAAACAGG No data
1069991824_1069991826 11 Left 1069991824 10:72320975-72320997 CCATCTGGCTGATGCAAGGCTTG No data
Right 1069991826 10:72321009-72321031 TAACCCCAGCCGGTACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069991826 Original CRISPR TAACCCCAGCCGGTACAAAC AGG Intergenic
No off target data available for this crispr