ID: 1069991993

View in Genome Browser
Species Human (GRCh38)
Location 10:72321748-72321770
Sequence CTGTGATAGGGAAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069991993_1069992006 -9 Left 1069991993 10:72321748-72321770 CCCTCCCCCTTTCCCTATCACAG No data
Right 1069992006 10:72321762-72321784 CTATCACAGGTGGGGCCAGGTGG No data
1069991993_1069992009 13 Left 1069991993 10:72321748-72321770 CCCTCCCCCTTTCCCTATCACAG No data
Right 1069992009 10:72321784-72321806 GAATGTCACAGTAAGTCCTTGGG No data
1069991993_1069992010 22 Left 1069991993 10:72321748-72321770 CCCTCCCCCTTTCCCTATCACAG No data
Right 1069992010 10:72321793-72321815 AGTAAGTCCTTGGGATAGAAAGG No data
1069991993_1069992008 12 Left 1069991993 10:72321748-72321770 CCCTCCCCCTTTCCCTATCACAG No data
Right 1069992008 10:72321783-72321805 GGAATGTCACAGTAAGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069991993 Original CRISPR CTGTGATAGGGAAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr