ID: 1069998099

View in Genome Browser
Species Human (GRCh38)
Location 10:72355335-72355357
Sequence AAACCATGCCTCACAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069998099_1069998106 25 Left 1069998099 10:72355335-72355357 CCACTGTTTGTGAGGCATGGTTT 0: 1
1: 0
2: 1
3: 11
4: 226
Right 1069998106 10:72355383-72355405 AAACAAAGCTCCTGCTCTCATGG No data
1069998099_1069998105 -4 Left 1069998099 10:72355335-72355357 CCACTGTTTGTGAGGCATGGTTT 0: 1
1: 0
2: 1
3: 11
4: 226
Right 1069998105 10:72355354-72355376 GTTTTATGATGGGGATACAGGGG No data
1069998099_1069998104 -5 Left 1069998099 10:72355335-72355357 CCACTGTTTGTGAGGCATGGTTT 0: 1
1: 0
2: 1
3: 11
4: 226
Right 1069998104 10:72355353-72355375 GGTTTTATGATGGGGATACAGGG No data
1069998099_1069998103 -6 Left 1069998099 10:72355335-72355357 CCACTGTTTGTGAGGCATGGTTT 0: 1
1: 0
2: 1
3: 11
4: 226
Right 1069998103 10:72355352-72355374 TGGTTTTATGATGGGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069998099 Original CRISPR AAACCATGCCTCACAAACAG TGG (reversed) Intergenic
900472201 1:2860517-2860539 AGACCATGCCACACACAGAGAGG + Intergenic
901497991 1:9633232-9633254 AAACCACGCCTGACAAATTGGGG - Intergenic
902706285 1:18207433-18207455 AAACCATGCCTCACATGAGGTGG - Intronic
903258402 1:22117895-22117917 ATACTATGCCTCACTAGCAGAGG - Exonic
906029044 1:42702618-42702640 AAACAATGCCTCACAGCCAAAGG - Intergenic
907680464 1:56558602-56558624 AAAAAATACCTCACAGACAGTGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910200911 1:84697601-84697623 AAACCATACCTCAAGAACAAAGG + Intergenic
910337587 1:86152944-86152966 AAACCATGTTTAACAAGCAGAGG - Intronic
910351170 1:86299349-86299371 AAGCAATGCCCCACAAACACAGG - Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
914225251 1:145714632-145714654 AAACCAAGCCTCAGAGCCAGAGG - Intergenic
915541780 1:156572068-156572090 AGACAATGCCTGTCAAACAGGGG - Intronic
916661844 1:166929494-166929516 AAACCATGCTTTACACATAGTGG + Intronic
917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
918805535 1:189036761-189036783 GAACCATGCCTCACAAAGCAAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919458305 1:197846211-197846233 AAACCATGTCTCAAAAAGAAAGG - Intergenic
920126111 1:203695029-203695051 AAACCCTCCCTCCCAAAAAGAGG - Intronic
921803377 1:219427615-219427637 CAACCATGCCTCTCTAACACTGG - Intergenic
922088839 1:222376438-222376460 TAACTATGCATCACAAACTGGGG + Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923972928 1:239226104-239226126 AAACCAACCCTAACAAACTGAGG - Intergenic
924788757 1:247223643-247223665 AAACCATGCTTCATAAATAAAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063437360 10:6045186-6045208 CAACCAGGCCTCAGAAACTGTGG - Intronic
1063898529 10:10707564-10707586 AAACCATCCCTCCCCATCAGAGG + Intergenic
1064104902 10:12492672-12492694 ATACCATGACTGTCAAACAGTGG - Intronic
1067263189 10:44712608-44712630 AAACCATGCTTTCCAGACAGTGG - Intergenic
1067328154 10:45289401-45289423 AAACCTTTACCCACAAACAGAGG - Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1069998099 10:72355335-72355357 AAACCATGCCTCACAAACAGTGG - Intergenic
1072060410 10:91804731-91804753 AAACCATACTTCCCAAACTGAGG - Intronic
1072519897 10:96222093-96222115 ATACAGTGCCTCACACACAGAGG - Intronic
1074644598 10:115432680-115432702 AAAGCATGCCTCACAAAGGAGGG + Intronic
1074859498 10:117499631-117499653 AAACCATGCTTCACCCTCAGGGG + Intergenic
1074902142 10:117826978-117827000 AAACCACGCCTGACATACACAGG + Intergenic
1075228242 10:120649033-120649055 AAACAATGCATCATAAATAGTGG - Intergenic
1077087248 11:759925-759947 ACACCCAGTCTCACAAACAGAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1082781615 11:57292631-57292653 AAACCATGTCTCAAAAAAAAAGG + Intergenic
1084937335 11:72594132-72594154 ACTCCATGCCTGACATACAGTGG + Intronic
1086760255 11:90621108-90621130 AAACTAAGCTTCACAAGCAGAGG + Intergenic
1089609945 11:119663528-119663550 ATACAATGCCTCACACACAAAGG - Exonic
1090000394 11:122951501-122951523 AAACAATGCCTCAAACACTGTGG - Intronic
1090645014 11:128760366-128760388 AAAGCATGACACACAAGCAGAGG - Intronic
1095574199 12:43716100-43716122 AAACAAAGCATCACAAACAATGG - Intergenic
1096431018 12:51542895-51542917 GAACCATACCCCACACACAGGGG + Intergenic
1096771283 12:53937618-53937640 AAACTATTCCTCACTAAAAGAGG + Intergenic
1097159076 12:57033361-57033383 AAACCCTGTCTCAAAAAAAGAGG - Intronic
1098455468 12:70667851-70667873 AAACCAAGTCCCACAACCAGAGG - Intronic
1098481270 12:70964533-70964555 ATACCTTGCCTCACACACATAGG - Intergenic
1099174282 12:79402700-79402722 AAGCCCTGCCTCACACACTGAGG - Intronic
1100677296 12:96881319-96881341 AAACCATGCCTCAGAATGGGAGG - Intergenic
1100947366 12:99801100-99801122 AAACCAAGCCTCAAATAAAGAGG - Intronic
1102777203 12:115530919-115530941 AATCCCTGCCTCACATACGGTGG + Intergenic
1102956151 12:117060379-117060401 AAAGCATGTGTCACACACAGAGG - Intronic
1103938367 12:124488681-124488703 AGACCTTGCCACACACACAGAGG + Intronic
1107101049 13:36592916-36592938 AAACCAAGCCTCTCAATTAGAGG + Intergenic
1109050658 13:57477099-57477121 AAACCAATCCTTAAAAACAGAGG + Intergenic
1112134394 13:96560363-96560385 ACACTATGCCTCACAATAAGAGG + Intronic
1112462050 13:99611499-99611521 AAACAATACATCACAATCAGTGG - Intronic
1112464405 13:99630928-99630950 CAAACATGCTTCAGAAACAGGGG - Intronic
1113630992 13:111883779-111883801 AAACCAGGCATCACTAACACAGG + Intergenic
1113947170 13:114050908-114050930 GGTCCATGGCTCACAAACAGAGG + Intronic
1114235656 14:20821352-20821374 ATACCATGTCTCACATTCAGTGG + Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1117250280 14:53929797-53929819 TCTCCATTCCTCACAAACAGTGG + Intergenic
1117305710 14:54471279-54471301 CAACCAAGCCTCAGAAAAAGGGG + Intergenic
1117702144 14:58424895-58424917 AAACCTAGCATCACAAACATGGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119386864 14:74262760-74262782 AAACCATTCCCCACCCACAGTGG - Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121000386 14:90447928-90447950 AAACATTGCCACTCAAACAGGGG - Intergenic
1121627630 14:95398171-95398193 CAACCATGCACCACACACAGAGG - Intergenic
1122540905 14:102497201-102497223 AAAGGCTGCCTCACAGACAGCGG - Intronic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1126054651 15:44718754-44718776 AAACCATGGATCAAAAACACTGG - Exonic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1128229934 15:66027392-66027414 TCACCATCCCTCACAGACAGGGG + Intronic
1129708705 15:77809307-77809329 AAACCAGGCCTCAAAGGCAGCGG + Intronic
1130174852 15:81557918-81557940 AAACTAAGCTTCATAAACAGAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1135801513 16:25501312-25501334 AAACCATGTCTAAAAAAAAGGGG + Intergenic
1135962133 16:27004189-27004211 AAACTATGCCTTACATATAGAGG + Intergenic
1137327718 16:47458970-47458992 TACTCATACCTCACAAACAGTGG + Intronic
1137604508 16:49778569-49778591 AAGCCATGCCTCACCAACCACGG + Intronic
1141402132 16:83758225-83758247 AAACCTTGTCTCATAAAAAGAGG - Intronic
1142173996 16:88636641-88636663 TAACCATGCACCACAAACTGGGG - Intergenic
1143357664 17:6342580-6342602 AAACAGTGCCTCCTAAACAGAGG + Intergenic
1143540810 17:7567674-7567696 AAACCATGGCTGAGGAACAGAGG + Intronic
1145199734 17:20932700-20932722 AGACCCTGCCTCAAAAACAAAGG - Intergenic
1148812481 17:50302571-50302593 ACACAATGCCTAGCAAACAGTGG - Intergenic
1150584534 17:66505427-66505449 AAAACATGCCTTCCAAACACTGG - Intronic
1154306149 18:13232353-13232375 AAACCATGCCAGGCAAAAAGGGG - Intronic
1155124840 18:22863104-22863126 AAAACATGCCACACAAAAACTGG - Intronic
1155394172 18:25368656-25368678 AAACCAGGCCACACAAAAGGAGG - Intergenic
1158328589 18:56337125-56337147 AAAACATGCATTACATACAGAGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1161882889 19:6969275-6969297 ACACAATGCCTGACACACAGTGG + Intergenic
1164931502 19:32179351-32179373 TGACCATGCCTCACCAGCAGTGG - Intergenic
1166061677 19:40329494-40329516 AAACCCAGTCTCAAAAACAGGGG + Intronic
925476571 2:4223445-4223467 ACATCGTGCCTCAGAAACAGGGG - Intergenic
926544461 2:14222254-14222276 AAACCATACCCTACAAATAGAGG + Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
930952622 2:57161719-57161741 AAACAATGCCTCAGACACAGGGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG + Intronic
935550349 2:104446432-104446454 AAACCAGGCCACACATACAGTGG + Intergenic
937064302 2:119005738-119005760 AGGCCATGCCTCACATTCAGTGG - Intergenic
937573753 2:123393880-123393902 AAACTAAGCTTCATAAACAGCGG + Intergenic
937995354 2:127690328-127690350 ACACCATGCCCCACATCCAGGGG + Intergenic
938175727 2:129126785-129126807 AAACCAAGCATCACTTACAGTGG + Intergenic
939633309 2:144551367-144551389 AAAACATCCCTGAAAAACAGTGG - Intergenic
942145568 2:173023291-173023313 AAATCATGGCTCAAAAACCGTGG + Intronic
943203842 2:184864578-184864600 AAACTATGCCTCCCAAACCATGG + Intronic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
1170157514 20:13282089-13282111 GAACCATTCATCTCAAACAGAGG - Intronic
1170545131 20:17429526-17429548 AAGCCATCCCTGCCAAACAGAGG + Intronic
1170671345 20:18436835-18436857 AAACCACGCATCAAAAACAATGG + Intronic
1175086154 20:56460915-56460937 GAACCAAGCCTCACAAAGATGGG - Intergenic
1175107684 20:56626636-56626658 AAACCAGGCCTCTGCAACAGCGG - Intergenic
1175179102 20:57132451-57132473 AAACCATCTCAGACAAACAGGGG - Intergenic
1178999853 21:37446997-37447019 AACCCATCCCTCTCACACAGGGG - Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179406305 21:41128636-41128658 ATGCCATGCCTCAGAAACTGTGG + Intergenic
1181462088 22:23091905-23091927 AAACCATCCCTAACACAAAGGGG - Intronic
953333435 3:42073499-42073521 AACCCCTGCCTCACAAAATGGGG + Intronic
954880697 3:53833952-53833974 AAGCCTTGCCTCCCACACAGTGG - Intronic
955044872 3:55350337-55350359 AAGCCATTCCTCACAAATATGGG + Intergenic
956278535 3:67530069-67530091 TAAAGATGACTCACAAACAGAGG - Intronic
956426140 3:69137660-69137682 AGACCCTGCCTCAAAAAAAGGGG - Intergenic
956800655 3:72755051-72755073 AAAGCATACCCCACACACAGGGG + Intronic
960137062 3:114116123-114116145 CAACCATGACTGAGAAACAGTGG + Intergenic
960365289 3:116763508-116763530 GAACCATGTCTCCCAAAAAGAGG + Intronic
960912491 3:122663244-122663266 AAACCAGGACACACAAACATTGG - Intergenic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
962878693 3:139555715-139555737 AAAACATGCCTCAGAAACACTGG + Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
967572588 3:191047964-191047986 AAACCATGTTTCAAAAATAGAGG - Intergenic
969231170 4:5832706-5832728 AAATCTTGCCTCACACAGAGAGG + Intronic
972606079 4:40615152-40615174 AAACCATGCATGGCATACAGTGG + Intronic
973873586 4:55191385-55191407 AAACCAAGCTTCACAAGCAAAGG + Intergenic
974408199 4:61504000-61504022 AAACCCTGTCTTACAAAAAGGGG - Intronic
974968648 4:68797998-68798020 AAAACATGCCTTAAATACAGAGG + Intergenic
975999687 4:80359065-80359087 AAACCAAGCTTCATAAACAAAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977007285 4:91584877-91584899 AAGACATGTGTCACAAACAGTGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979288794 4:118957186-118957208 AAGCCATTCCCCACAAACACAGG + Intronic
979318744 4:119299095-119299117 AAACCCTGTCTCAAAAAAAGGGG - Intronic
979739948 4:124137359-124137381 AAACTATGCATCAAAAAAAGAGG + Intergenic
979838044 4:125398412-125398434 AAATGCTGCCTGACAAACAGAGG - Intronic
979879397 4:125936035-125936057 AAACAATACCCCACAAACACAGG + Intergenic
980701324 4:136435161-136435183 AAAAGATGCCTCACAAGTAGGGG - Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982474964 4:155839251-155839273 AAACTAAGCCTCAGAAAGAGTGG + Intronic
984815019 4:183828164-183828186 AAACCGTGCCTTGCAAACATGGG - Intergenic
986084409 5:4429687-4429709 AAAACATGGCTCATGAACAGAGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
989640859 5:43581693-43581715 AAATCATGCCTCATAGATAGTGG + Intergenic
993971750 5:94428492-94428514 AAACTAAGCTTCACAAACAAAGG - Intronic
994349268 5:98725697-98725719 AATCCTTGCCTCACCAGCAGAGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998997236 5:147878929-147878951 AAGCCTTGCCTCACTGACAGTGG + Intronic
999497020 5:152109058-152109080 AGACCATTCCTGACAGACAGGGG + Intergenic
999841020 5:155426568-155426590 AAACTATGTTTCTCAAACAGGGG - Intergenic
1000198871 5:158988004-158988026 AAACGGTGCTTCAGAAACAGAGG - Intronic
1002787214 6:411297-411319 AAAGGATGCTTCACAAACTGAGG + Exonic
1004633852 6:17447829-17447851 AAACCATGCCTCAGAAAGGTTGG + Intronic
1005901322 6:30219239-30219261 AATCCATAACTCACAAACTGGGG - Intergenic
1007413469 6:41678582-41678604 AGACCCTGCCTCAAAAACAAGGG + Intergenic
1010214768 6:73391928-73391950 TAACCATGACTCATAAACAATGG - Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013655464 6:112242217-112242239 AAACCATGGCACACACACACTGG - Intronic
1014758304 6:125326559-125326581 CTACCATGCCTCAAAAAAAGGGG + Intergenic
1015750493 6:136553650-136553672 CTACCGTGCCTCACACACAGTGG + Intergenic
1016887141 6:148969223-148969245 AAACAATGCCTTAGAAATAGAGG - Intronic
1016909960 6:149189035-149189057 AAACTAAGCTTCACAAACAAAGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017813728 6:158002180-158002202 GAACCATGCCTGGCACACAGTGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1020223713 7:6262747-6262769 AAACTATCCTTCAAAAACAGAGG + Intronic
1022662001 7:32376190-32376212 CAACCAATCCTAACAAACAGTGG + Intergenic
1023059087 7:36312126-36312148 AGACCCTGTCTCAAAAACAGTGG - Intergenic
1024295688 7:47840133-47840155 ACACCATGTGTCACAAACTGGGG + Intronic
1024609532 7:51052641-51052663 AATCAATGCCTCAGAAAGAGAGG + Intronic
1024701254 7:51906594-51906616 AAAACAGGCCTCACAATCACAGG + Intergenic
1024878978 7:54063529-54063551 AAGCCATGCCTTACAAAAACAGG + Intergenic
1028030793 7:85909384-85909406 AAACTAAGCTTCACAAACAAAGG + Intergenic
1029453114 7:100653637-100653659 AGACTTTGCCTCAAAAACAGGGG - Intronic
1031068936 7:117140898-117140920 AATCCTTGCACCACAAACAGAGG + Intronic
1032071892 7:128812934-128812956 AAACCCTGCCTCCCTGACAGTGG - Intronic
1038973803 8:32669004-32669026 AAACTCTGCCTCACAAACTGTGG - Intronic
1043306249 8:78800305-78800327 AAACCCTGTCTCAAAAAGAGAGG - Intronic
1044594493 8:93944665-93944687 AAACTGTGACTCACACACAGAGG + Intergenic
1044840135 8:96330227-96330249 AAATCATGCCGTACAGACAGAGG - Exonic
1045144814 8:99330013-99330035 AAACAGTGACTCTCAAACAGGGG - Intronic
1045851665 8:106706994-106707016 AAATCAGGACTCACAGACAGAGG + Exonic
1045949492 8:107835523-107835545 GAACCAGGCCTCACAGACAGTGG + Intergenic
1046242600 8:111516333-111516355 ACACCATGCCTCTCAAACTGCGG + Intergenic
1046330617 8:112710232-112710254 AAACTATGAGTGACAAACAGTGG + Intronic
1047709613 8:127538542-127538564 AAACCAGGACTGTCAAACAGTGG + Intergenic
1048893054 8:138964931-138964953 AGACCATGGCTCACACTCAGTGG - Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1055222491 9:73953630-73953652 AAACTAAGCTTCACAAACAAAGG + Intergenic
1055505491 9:76944133-76944155 AAACAATGCCTCAGAAAAACAGG + Intergenic
1056317028 9:85400084-85400106 AAGCCATGTCTCACAAACAAAGG + Intergenic
1057214859 9:93222176-93222198 AGACCCTGCCTCAAAAAAAGGGG - Intronic
1060732929 9:126049480-126049502 GACCCCTGCCTCACAGACAGGGG - Intergenic
1061040209 9:128137252-128137274 AAATCATGCCTAACTGACAGTGG + Intergenic
1062720107 9:138036511-138036533 AAACCACGTCTCACAAACAATGG - Intronic
1186521819 X:10213122-10213144 AAACCATGCCTCAAGTACACAGG - Intronic
1187484216 X:19686713-19686735 GAGCCATGCTTCACAAACTGGGG - Intronic
1188531933 X:31151562-31151584 AAACCATGCCTCTTGAACAAGGG - Intronic
1188899201 X:35709106-35709128 AAACATTGTCTCACAGACAGTGG + Intergenic
1191117192 X:56864601-56864623 ATACTATGCCTTACAAAAAGGGG + Intergenic
1191722813 X:64248793-64248815 AAACCGTGCCTCACCACGAGAGG - Intergenic
1193894572 X:87097343-87097365 AAACTATGCTTCACAAGCAAAGG - Intergenic
1195127237 X:101820840-101820862 AAACTAAGCCTCATAAACAAAGG - Intergenic
1195548605 X:106140523-106140545 AAACCAAGCCTCATAAGCAAAGG + Intergenic
1196240386 X:113337148-113337170 AAACAATGCCTCTAAAACAGTGG - Intergenic
1197380911 X:125737368-125737390 AAACCAAGCCTCACCACCACAGG - Intergenic
1197584246 X:128325163-128325185 GAGTCATGCCTAACAAACAGAGG - Intergenic
1198325144 X:135563801-135563823 AAACAATACCTCACTTACAGAGG - Intronic
1199405452 X:147453261-147453283 AGACCATGCTTCAGAAACAGTGG - Intergenic
1199464534 X:148121314-148121336 AAACCAAGCCACAGAAACAAAGG - Intergenic
1199830477 X:151544729-151544751 AGACCCTGTCTCAAAAACAGAGG + Intergenic
1200241664 X:154498527-154498549 AGACCCTGTCTCAAAAACAGTGG - Intergenic
1201268173 Y:12228970-12228992 TCACCATGCCTGACACACAGTGG - Intergenic