ID: 1070002386

View in Genome Browser
Species Human (GRCh38)
Location 10:72389569-72389591
Sequence CAGTGTAAGTAGAATTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070002384_1070002386 3 Left 1070002384 10:72389543-72389565 CCAACTATGCCATAAATTATAAT 0: 1
1: 0
2: 0
3: 20
4: 283
Right 1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG No data
1070002385_1070002386 -6 Left 1070002385 10:72389552-72389574 CCATAAATTATAATTTTCAGTGT No data
Right 1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070002386 Original CRISPR CAGTGTAAGTAGAATTGTGC AGG Intronic
No off target data available for this crispr