ID: 1070015356

View in Genome Browser
Species Human (GRCh38)
Location 10:72523826-72523848
Sequence ATATACTTACAGACGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070015356_1070015359 -10 Left 1070015356 10:72523826-72523848 CCTTGGCCCGTCTGTAAGTATAT 0: 1
1: 0
2: 0
3: 0
4: 75
Right 1070015359 10:72523839-72523861 GTAAGTATATATTCTTTTCATGG 0: 1
1: 0
2: 2
3: 59
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070015356 Original CRISPR ATATACTTACAGACGGGCCA AGG (reversed) Intronic
900830092 1:4959736-4959758 ATACACATACAGAGGGCCCAAGG - Intergenic
906987911 1:50706857-50706879 ACATAGTTACAGATGGGCAAAGG - Intronic
908506811 1:64811092-64811114 ACATACTTACAGACCGTACATGG + Intronic
908546737 1:65169560-65169582 ATATATTGACAGCCTGGCCAGGG + Intronic
911690386 1:100826421-100826443 ACATAGGTACAGACGTGCCATGG + Intergenic
920311523 1:205051663-205051685 ATATCCTTCCTGACGGGCCCTGG + Intronic
1065738235 10:28773131-28773153 ATATACTTAAAGAAGTGCTAAGG + Intergenic
1070015356 10:72523826-72523848 ATATACTTACAGACGGGCCAAGG - Intronic
1080549938 11:33364498-33364520 ATATACTTACAGCCAGCCTAAGG + Intergenic
1084704720 11:70809517-70809539 ATAAAGTTACAGAAGGGCAATGG + Intronic
1086275475 11:85123265-85123287 ATATACATACAGGCCGGGCATGG - Intronic
1088059292 11:105626798-105626820 ATTTTCTTACAGAAGGGGCAGGG + Intronic
1090482763 11:127082625-127082647 ATACACGTACACACGTGCCATGG + Intergenic
1091515188 12:1172832-1172854 ATTTACAGACAGACGGACCAAGG - Intronic
1095983173 12:47984077-47984099 AGGTACTTACAGCAGGGCCAGGG + Exonic
1110697641 13:78510420-78510442 AAATACTTACAGACGAGGCCGGG - Intergenic
1111167364 13:84476991-84477013 ACATAGTTACACACGTGCCATGG - Intergenic
1113567459 13:111327390-111327412 AACAACTTACAGAGGGGCCAGGG + Intronic
1139810099 16:69607972-69607994 ATATAATTTCAAAAGGGCCATGG + Intronic
1142319933 16:89375036-89375058 AAATACTTACAGACTGTACATGG + Intronic
1148793824 17:50187866-50187888 GCATACTTACAGGAGGGCCAGGG + Exonic
1156780960 18:40850176-40850198 ATATTCTTACAGACTGACTAAGG - Intergenic
1157724580 18:49954259-49954281 GTCTACTTAGAGAGGGGCCAAGG + Intronic
1161472620 19:4466911-4466933 ATATATAAACAGACGGGGCATGG - Intergenic
1162457951 19:10797154-10797176 GTGTAGTTACAGAAGGGCCACGG - Intronic
1165066923 19:33234988-33235010 ATTGACTTACAGACTGGACATGG + Intergenic
1165600028 19:37046717-37046739 ATACATTTACATACAGGCCAAGG + Intronic
927411575 2:22831869-22831891 ATATAGGTACACACGTGCCATGG - Intergenic
934747184 2:96767096-96767118 ACACACTTAGAGACGGGCTAGGG + Intronic
936768978 2:115889103-115889125 ACATACTTATACACGTGCCATGG + Intergenic
942293608 2:174496689-174496711 ACAGACTTACAGGCTGGCCATGG - Intergenic
943528810 2:189052739-189052761 ATAAACTTACAGGCGGACCTTGG + Exonic
943828567 2:192428332-192428354 ATAGCCTTACATATGGGCCATGG - Intergenic
1170111526 20:12808926-12808948 ATATACCTTCAGAAGGCCCAGGG + Intergenic
1183301390 22:37060762-37060784 AGACACTAACAGAGGGGCCAGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954986308 3:54796514-54796536 ATATATTTACCAATGGGCCAAGG + Intronic
961661012 3:128468805-128468827 ATGGACAGACAGACGGGCCAAGG + Intergenic
963245016 3:143049897-143049919 ATATACTTATATACTGGCAATGG - Intronic
964408333 3:156373256-156373278 AAACAATTACAGCCGGGCCAGGG + Intronic
965276509 3:166690128-166690150 ATAGACTTACTGAGGTGCCAAGG - Intergenic
983990915 4:174118578-174118600 AAATAATTGCAGACAGGCCATGG - Intergenic
984323382 4:178222960-178222982 ACATACTTACAGACAGACTATGG - Intergenic
985803847 5:2024457-2024479 ATATACTTACAGAAGTTCTACGG - Intergenic
986646397 5:9920751-9920773 ATAAACATACAAACGGGCAATGG - Intergenic
987253220 5:16121633-16121655 TTCTAATTACAGAAGGGCCAAGG + Intronic
994175648 5:96707943-96707965 CTATACTAACAGAGTGGCCAGGG + Intronic
1000049614 5:157550799-157550821 ATAAACTTGCAGAGGAGCCAAGG + Intronic
1000055157 5:157599559-157599581 GTAAACTCACAGAGGGGCCATGG + Intergenic
1009591244 6:65673506-65673528 ATACACTTAGAGAGTGGCCAAGG + Intronic
1013716789 6:112971546-112971568 TCATACTTTCACACGGGCCATGG - Intergenic
1014511183 6:122324656-122324678 ACATACTTACAGACTGTACATGG - Intergenic
1014790967 6:125671634-125671656 ATATACATACACACAGGGCAAGG - Intergenic
1020815826 7:12904276-12904298 ACATACTTAAACACGTGCCATGG - Intergenic
1025141454 7:56470256-56470278 ATACAATTACAGACGTGACAAGG + Intergenic
1027386822 7:77667031-77667053 ATATACTGACTGACGGGGCGTGG - Intergenic
1028104679 7:86863043-86863065 ATATACAAATAGACAGGCCAAGG + Intronic
1028754721 7:94421940-94421962 ATTTACTTACAGAGGGTCCTGGG - Exonic
1034084070 7:148307675-148307697 ATATACATAGAGACTGGGCATGG + Intronic
1035197606 7:157235590-157235612 ATATATTTACAGAAGATCCAGGG + Intronic
1037951491 8:23021292-23021314 AGATGCTTACAGAGCGGCCAAGG + Exonic
1040897075 8:52379741-52379763 ATATACTTACAGACCATACATGG + Intronic
1040906988 8:52479439-52479461 ATAAACATACCGATGGGCCAAGG - Intergenic
1041414073 8:57588198-57588220 ATATACTCACAGACTAGGCATGG - Intergenic
1042283137 8:67077307-67077329 ATATTCATACAGACTGGGCATGG - Intronic
1044622507 8:94204197-94204219 ATATAGGTATAGACGTGCCATGG + Intronic
1044992342 8:97807274-97807296 AAGTAATTACAGACTGGCCACGG + Intronic
1059090233 9:111348814-111348836 ATAAACATACAGAGGGGTCATGG + Intergenic
1185711340 X:2305919-2305941 ATATAGGTATAGACGTGCCATGG - Intronic
1185741334 X:2535109-2535131 ACATACATACACACGTGCCATGG - Intergenic
1185977496 X:4737989-4738011 ATTTACTTACAGATGAGCCTCGG + Intergenic
1193255090 X:79339373-79339395 ATATAGTTATACACGTGCCATGG + Intergenic
1194958508 X:100208869-100208891 ACATACTTATACACGTGCCATGG + Intergenic
1195706961 X:107744048-107744070 ATCTACCTACAGTCTGGCCACGG - Intronic
1197617071 X:128704758-128704780 ATATAATTATACACGTGCCATGG - Intergenic
1198136853 X:133761437-133761459 ATATATTTACAGGCTGGTCATGG - Intronic