ID: 1070027132

View in Genome Browser
Species Human (GRCh38)
Location 10:72642431-72642453
Sequence AGTCACCCGCTTCCAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070027132_1070027137 28 Left 1070027132 10:72642431-72642453 CCACACATTGGAAGCGGGTGACT No data
Right 1070027137 10:72642482-72642504 AAACTGCACTTGAAACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070027132 Original CRISPR AGTCACCCGCTTCCAATGTG TGG (reversed) Intergenic
No off target data available for this crispr