ID: 1070033152

View in Genome Browser
Species Human (GRCh38)
Location 10:72696521-72696543
Sequence ACAGAAGACAACAATAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070033152_1070033153 -4 Left 1070033152 10:72696521-72696543 CCTTTTCTATTGTTGTCTTCTGT No data
Right 1070033153 10:72696540-72696562 CTGTCCTCTCTGAATTCTGATGG No data
1070033152_1070033154 -3 Left 1070033152 10:72696521-72696543 CCTTTTCTATTGTTGTCTTCTGT No data
Right 1070033154 10:72696541-72696563 TGTCCTCTCTGAATTCTGATGGG No data
1070033152_1070033156 13 Left 1070033152 10:72696521-72696543 CCTTTTCTATTGTTGTCTTCTGT No data
Right 1070033156 10:72696557-72696579 TGATGGGATTTATTATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070033152 Original CRISPR ACAGAAGACAACAATAGAAA AGG (reversed) Intronic
No off target data available for this crispr