ID: 1070037182

View in Genome Browser
Species Human (GRCh38)
Location 10:72737814-72737836
Sequence CAGAAAAAGGGGAAATAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 1, 2: 3, 3: 65, 4: 602}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070037182_1070037189 26 Left 1070037182 10:72737814-72737836 CCAGCCTATTTCCCCTTTTTCTG 0: 1
1: 1
2: 3
3: 65
4: 602
Right 1070037189 10:72737863-72737885 GAGTGAGCTGTATAGGCACCAGG No data
1070037182_1070037190 27 Left 1070037182 10:72737814-72737836 CCAGCCTATTTCCCCTTTTTCTG 0: 1
1: 1
2: 3
3: 65
4: 602
Right 1070037190 10:72737864-72737886 AGTGAGCTGTATAGGCACCAGGG No data
1070037182_1070037188 19 Left 1070037182 10:72737814-72737836 CCAGCCTATTTCCCCTTTTTCTG 0: 1
1: 1
2: 3
3: 65
4: 602
Right 1070037188 10:72737856-72737878 AGTTCAAGAGTGAGCTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070037182 Original CRISPR CAGAAAAAGGGGAAATAGGC TGG (reversed) Intronic
900631044 1:3635482-3635504 AGGAAAAAGGGGAAATTGGGAGG + Intronic
901141146 1:7032259-7032281 CAGAAAAAGAGAAAAGGGGCCGG - Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901806776 1:11743540-11743562 AAGAAAAAGGGCAGATGGGCTGG - Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902203334 1:14850228-14850250 TAGAAAAAGCATAAATAGGCTGG - Intronic
902751442 1:18514397-18514419 CAGAAAATGGGGAGATAGGTGGG - Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903613411 1:24633717-24633739 TATAAGAAGGGGAAATTGGCTGG - Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904209630 1:28878317-28878339 AAAAAAAAGAGGAAATGGGCTGG + Intergenic
904567736 1:31437781-31437803 CAGAAAAATAGGAAGTTGGCTGG + Intergenic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
905698462 1:39993567-39993589 AAGAAAAGAGGAAAATAGGCCGG - Intergenic
906080750 1:43086654-43086676 CAGAAAAGGGGGAAAGGGGTCGG - Intergenic
906606734 1:47178010-47178032 GAGAAAAAGGGGAATGAGACAGG - Intergenic
906721928 1:48013097-48013119 CAGAAAACGGGGAAATAGAATGG - Intergenic
907033002 1:51190992-51191014 CAGATAAAGGGAAAATACGTGGG - Intergenic
907596633 1:55726315-55726337 TAGAAAATGGGGAAATGGGGGGG + Intergenic
907771482 1:57469397-57469419 CAGAAAAAGGAGAAAAAAGTTGG + Intronic
908878346 1:68702887-68702909 TAGAAGAAGGGGCAATAGGTGGG - Intergenic
909151857 1:72016501-72016523 CATAAAGATGGGAAATAGACTGG + Intronic
909653683 1:78005389-78005411 GAGAGAGAGGGGAAAAAGGCTGG - Intronic
911552015 1:99294103-99294125 AAAAAAAAGGAGAAATAAGCTGG + Intronic
912359148 1:109080435-109080457 AAGAAAAAGGGGAAAGAAGTTGG + Intergenic
912421593 1:109545754-109545776 CATCAAAAGGGGAAATGGGCTGG + Exonic
912758724 1:112346947-112346969 CAGAGAAAAGGGAAAAAGACTGG + Intergenic
913161216 1:116147626-116147648 CAGAAAGGAGGGAAATAGACTGG + Intergenic
913181023 1:116321607-116321629 CATGAAATGGGGAAATAGGTGGG + Intergenic
913233806 1:116763495-116763517 CAGCAACAGGGGAAACAGGAGGG - Intronic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
916127916 1:161587980-161588002 CAGAAAAATAGAAAATACGCAGG - Intronic
916137834 1:161669810-161669832 CAGAAAAATAGAAAATACGCAGG - Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
917030748 1:170687939-170687961 GAGAAAAAGGGGAAAAAGAAAGG + Intronic
917403974 1:174683669-174683691 CAGATAAATGGGAAATAAGAAGG - Intronic
917479753 1:175402009-175402031 CATAAAAAAGGGAATCAGGCCGG + Intronic
918550822 1:185740271-185740293 CAGAAACAGGGAGAATAGACAGG + Intronic
918737794 1:188088137-188088159 CAGAAAAAGGGGAAAAATGTTGG - Intergenic
918809615 1:189099313-189099335 TAGGAAAACAGGAAATAGGCAGG + Intergenic
919007835 1:191922332-191922354 CAGAAGAAATGGAAATAGACAGG + Intergenic
919572263 1:199263584-199263606 AAGAAAAAAAGGAAATGGGCAGG + Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919916114 1:202140435-202140457 CAGATAAAAGGGAATTGGGCTGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920725063 1:208427292-208427314 TACAAAAAGGGGAAATTGGCTGG + Intergenic
921509100 1:216009159-216009181 CAGAAAAGTGGGAAAGAGGTTGG - Intronic
921725871 1:218522773-218522795 AAAAAAAAAGGGAAATAGGTCGG - Intergenic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
922156913 1:223047755-223047777 CAGAAGAAGGTGGGATAGGCTGG - Intergenic
922273637 1:224056826-224056848 CGGAAAAAGGAGGAATAGGGAGG - Intergenic
922458644 1:225797759-225797781 GAGAAAAAGGGGAAATCTCCTGG - Intergenic
923185697 1:231571087-231571109 CAGAGAAAGGGAACATAGGATGG + Intronic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
923715068 1:236418247-236418269 CAGAAAAAAAGAAAAGAGGCCGG - Intronic
924512884 1:244742346-244742368 CAGAGAGAGAGAAAATAGGCCGG + Intergenic
924648099 1:245898413-245898435 CAGAAAAAGGGAACAAAAGCAGG + Intronic
1063641676 10:7836568-7836590 AAGAAAATGTGGAAATGGGCCGG - Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063751854 10:8958345-8958367 TTAAAAAAGGGCAAATAGGCCGG + Intergenic
1065505533 10:26426707-26426729 CAGAAAAAGGATAAAAAGGTTGG + Intergenic
1066698648 10:38102129-38102151 CAGAAATTGGCAAAATAGGCTGG - Intronic
1066994009 10:42546098-42546120 CAGAAATTGGCAAAATAGGCTGG + Intergenic
1067126077 10:43516669-43516691 CAGAAAAATGTGAAAAAGACTGG - Intergenic
1067390513 10:45858862-45858884 CACAAAAAGGGATAATTGGCCGG - Intergenic
1067593632 10:47534949-47534971 CACAAAAAGGGATAATTGGCCGG - Intronic
1067640741 10:48043059-48043081 CACAAAAAGGGATAATTGGCCGG - Intergenic
1067798697 10:49340951-49340973 CATAAAAATGGGAAATATGTGGG + Intergenic
1067872764 10:49977214-49977236 CACAAAAAGGGATAATTGGCTGG + Intergenic
1068352718 10:55869519-55869541 CAGAAATAAGGGAAACAGGCCGG - Intergenic
1069157575 10:65050907-65050929 GAGAAAAAGAGAAAACAGGCCGG - Intergenic
1069239938 10:66126970-66126992 TAGAAAAGGGGGAAAATGGCCGG + Intronic
1069454279 10:68541378-68541400 TAGAAAAAGAGAAAATAGGCTGG - Intergenic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070050215 10:72881572-72881594 CATGAAGAGGGTAAATAGGCTGG + Intronic
1071479427 10:86053744-86053766 CAGGGAAAGGGGAAAGATGCAGG + Intronic
1071530180 10:86384437-86384459 CAGAAAAAGAGGAACCAGGCAGG + Intergenic
1071542677 10:86501850-86501872 AATAAAAAGGGGAGTTAGGCAGG - Intronic
1072095028 10:92169733-92169755 CAGTAAAAGTGGGATTAGGCTGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1073184867 10:101609783-101609805 CACAAAAAGGGAGAATAGGGTGG + Intergenic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074618274 10:115092783-115092805 GAGAAAAAGAAGAAATAGGCAGG + Intergenic
1075008263 10:118845999-118846021 AAGAAAAAAGGGAAAATGGCGGG + Intergenic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075828955 10:125387593-125387615 CAGAAAAATGGGCAAAAGACTGG - Intergenic
1077256808 11:1588509-1588531 ATGAAAAACGGCAAATAGGCTGG - Intergenic
1077683790 11:4271998-4272020 GAGAAAAAGGTGGACTAGGCAGG + Intergenic
1077686252 11:4294766-4294788 GAGAAAAAGGTGGACTAGGCAGG - Intergenic
1077691400 11:4345930-4345952 GAGAAAAAGGTGGACTAGGCAGG - Intergenic
1078114013 11:8426582-8426604 CAGAAATAGAGAAAACAGGCTGG - Intronic
1078813377 11:14794608-14794630 CAGAAATAATGGAATTAGGCTGG - Intronic
1079727246 11:23891742-23891764 CAGAAAAGCGGGAAAGGGGCCGG + Intergenic
1080142972 11:28944501-28944523 AATAAAAAGGGGACATGGGCTGG + Intergenic
1080420296 11:32103979-32104001 CAGCAAAGTGGGGAATAGGCAGG - Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1082912972 11:58397455-58397477 AAGAAAGAGGGGAAAGAGACAGG + Intergenic
1083178426 11:60968070-60968092 TAGAAAAAAATGAAATAGGCTGG - Intergenic
1083406525 11:62461129-62461151 AAAAAAAAGGGGAATTTGGCCGG - Intronic
1083682056 11:64355895-64355917 CAGAAAAAGTGAAAAGAGACAGG + Intronic
1083796062 11:65017490-65017512 CTTAAAAAGAGCAAATAGGCCGG - Intronic
1084389354 11:68865158-68865180 CAGAAACAGTGAAAATAGGCAGG + Intergenic
1085152355 11:74262395-74262417 GAGAAAGAAGGGAAAGAGGCAGG + Intronic
1085235672 11:75013418-75013440 CAGAAAGAGGGGAGGAAGGCAGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1086013294 11:82132203-82132225 CAGAAAAAGAGGAAAAAGAAAGG - Intergenic
1086504010 11:87483781-87483803 CAGAAAAATGGAACATATGCTGG - Intergenic
1087054196 11:93917610-93917632 CAGTAAAGGGGGAAAAAGTCAGG + Intergenic
1087149856 11:94849566-94849588 CAGGAAAAGGGGAAATTGTGGGG + Intronic
1087474527 11:98619715-98619737 CAGGAAAAGGTGAAAAAGGTTGG + Intergenic
1087601318 11:100319447-100319469 CAGAAAAAAGGGAAGTCAGCTGG - Intronic
1087911524 11:103759717-103759739 TAGAAAAAGAGGGAATCGGCCGG + Intergenic
1088464218 11:110116054-110116076 CAGAAAATGAGAAAACAGGCCGG - Intronic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1089701196 11:120245117-120245139 CAGAAATAGGGGAGAAAGTCAGG - Intronic
1089881722 11:121780517-121780539 CAGTAAAAGGGGAAATGAGAAGG - Intergenic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090593723 11:128298100-128298122 CTGAAAAAGGGCAAATGGGAAGG + Intergenic
1090759479 11:129823594-129823616 CAGAAACAGAGGAAATAGCAAGG - Intronic
1091257681 11:134204651-134204673 CAGAAACAGGGAAAATAGGCTGG - Intronic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1092029307 12:5270842-5270864 GAGAGAAAGTAGAAATAGGCAGG + Intergenic
1092278756 12:7082999-7083021 CAGAAAAAAGGGAAAAAATCTGG - Intronic
1093320757 12:17710917-17710939 AAAAAAAAGAGTAAATAGGCTGG + Intergenic
1093322153 12:17724837-17724859 CAGAAAAGAGGGAAACAGGTCGG + Intergenic
1094202014 12:27804347-27804369 AAGAAGAAGAGGAAATAGGGTGG - Intergenic
1094542405 12:31373322-31373344 CAAAAAAAGGGCAAATGGCCGGG - Intergenic
1094825599 12:34266802-34266824 CAGAAAAGCGGGAAAGAGGTCGG - Intergenic
1095173712 12:39065315-39065337 AAGAAAAAGGGGAGAAAGGCTGG - Intergenic
1096004232 12:48156071-48156093 CACAAAAAGCAAAAATAGGCCGG - Intronic
1096256470 12:50064987-50065009 CAGAACAAGGGGGAACATGCTGG + Intronic
1096356084 12:50942176-50942198 CAGAACAAGGGAACATGGGCCGG - Intergenic
1096749450 12:53749403-53749425 CAGACTAAGGGGAAATGGGGAGG + Intergenic
1096837207 12:54358537-54358559 CAGAGAAAGGCGCAATAGGGAGG - Intergenic
1097491520 12:60277478-60277500 AAGAAAAATGTGAAATAGCCTGG - Intergenic
1097622516 12:61957827-61957849 AAGAAATAAGGGAAAGAGGCAGG - Intronic
1099201189 12:79679057-79679079 CAGAAAAGGGGGCCATGGGCCGG - Intronic
1100491078 12:95078644-95078666 CAGAAAAAGGGAAAAGAGATTGG + Exonic
1100964632 12:99999159-99999181 TATAAAAAGAGGAAATTGGCCGG - Intergenic
1101043090 12:100776880-100776902 CAGAATATGAGGAAATATGCAGG + Intronic
1101609024 12:106273697-106273719 CGTAAGAAGTGGAAATAGGCCGG + Intronic
1101730624 12:107424310-107424332 TAGAGAAAGGAGAAAAAGGCAGG - Intronic
1101801807 12:108029039-108029061 CAGAAAAAGGGCACATCTGCTGG + Intergenic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102226873 12:111235013-111235035 CAGAAAGAGAGGAAGTGGGCTGG - Intronic
1102371884 12:112388683-112388705 CAGAAAACTGGGAAACAGGTAGG - Intergenic
1102633214 12:114300170-114300192 CAGAAAAAGGATATCTAGGCTGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102827216 12:115958932-115958954 CAAAAAAAGGGGAAATGGGGAGG - Exonic
1102852924 12:116267654-116267676 CAGTAAAATGGGAAATAACCTGG - Intronic
1103116363 12:118336773-118336795 TACAAAAAGGGCAAAGAGGCTGG + Intronic
1104681378 12:130754318-130754340 CCCAGAATGGGGAAATAGGCAGG - Intergenic
1105764837 13:23548927-23548949 CATAGAAAGGGGAAAAGGGCTGG - Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1107316154 13:39134319-39134341 AAGAAAAGGGGGAAATATGAAGG - Intergenic
1107550749 13:41472643-41472665 CAGAGAAATGCAAAATAGGCCGG - Intergenic
1107749142 13:43545585-43545607 CAGAAAACAGGGAGAGAGGCAGG - Intronic
1107791029 13:44002441-44002463 CAGAATAATGGGAAATAGTGTGG - Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108600696 13:51991858-51991880 ATGAAAAGGGGGAAATAGGGAGG - Intronic
1109194777 13:59366526-59366548 CAGAAAAAGGGACAAATGGCTGG + Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109642584 13:65209770-65209792 AAGGCAAAGGGGAAGTAGGCTGG + Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1110609154 13:77469840-77469862 CATAAAAAGGGGATCAAGGCTGG - Intergenic
1110953519 13:81523452-81523474 CAGAAAGAGGAGGAATAGGAGGG - Intergenic
1111201591 13:84945032-84945054 CAGAAAAACAGGAATTAGGGAGG + Intergenic
1111432016 13:88157846-88157868 AAGAAAAGGGGGAAATAGAATGG - Intergenic
1112414902 13:99195907-99195929 CAAAAAAATGAAAAATAGGCCGG + Intergenic
1112795029 13:103047553-103047575 AAGAAAAAGGGAAAAAAGGAAGG - Intronic
1113499117 13:110759514-110759536 CACACAAAGAGGAAACAGGCTGG - Intergenic
1114338963 14:21723356-21723378 CAGAAAGAAGGGAAATAGGATGG - Intergenic
1114461872 14:22891606-22891628 TAGAAAAAGGGCATACAGGCTGG - Intergenic
1114730247 14:24985547-24985569 CAGAAAAAGTGGGAACAGGAAGG - Intronic
1115414679 14:33118066-33118088 AAGAAAAGAGGGAAATAGACTGG - Intronic
1116187148 14:41611037-41611059 CAGAAGAAAGTGAAATAGGTGGG - Intronic
1116555733 14:46304261-46304283 CGGAAAAAGGGCCAATAGGAAGG - Intergenic
1116766864 14:49083229-49083251 CAGAAAATGGGGAAAATGTCTGG - Intergenic
1116969727 14:51051668-51051690 AAGAAAAAGATGGAATAGGCCGG + Intronic
1117442203 14:55770707-55770729 CAGAAAATGGTCAAATAGGTTGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118119704 14:62825848-62825870 TAGAAAAAAGGGAAACAGGAAGG - Intronic
1118165415 14:63331389-63331411 TGGAGAAAGGGGAAATGGGCTGG + Intergenic
1118303168 14:64633207-64633229 TATAAAAAGGGGAAGTCGGCCGG - Intergenic
1119386764 14:74262093-74262115 CAGAAGGATGGGAAAAAGGCTGG + Exonic
1119597263 14:75946840-75946862 CTGAAGAAGGGGGAATAAGCTGG + Intronic
1119995184 14:79245876-79245898 AAGAAAAAAGGGAAAGAGGAAGG + Intronic
1121413183 14:93761918-93761940 CAGAAAGAGGTGGAATATGCTGG - Intronic
1121470025 14:94145356-94145378 CAGAGAAAGGGAAAATAACCAGG - Intergenic
1121950675 14:98168203-98168225 CAAAAAACGGGGAAAAATGCTGG + Intergenic
1121964350 14:98290246-98290268 CAGAAAAAGGGGTCATCAGCAGG - Intergenic
1122146794 14:99694795-99694817 AAGAAAGAGGAGAAATTGGCTGG - Intronic
1122358155 14:101136617-101136639 CAGAACAAGGCCAAATAGACTGG - Intergenic
1122500062 14:102191421-102191443 CAGAAGAGGAGGAAATAGGATGG + Intronic
1125444324 15:39737024-39737046 CAGGGAAAGGGGATATGGGCAGG + Intronic
1125559295 15:40614527-40614549 CTGAAGAAGAGGGAATAGGCTGG - Intronic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1127655144 15:61048585-61048607 CAGAATAATCGGAAACAGGCTGG - Intronic
1128012437 15:64310708-64310730 CAAAAAAAAGGAAAAGAGGCCGG + Intronic
1128041050 15:64573707-64573729 TAGACAAGGGTGAAATAGGCAGG - Intronic
1128139808 15:65291236-65291258 AAGAAGAAGAGAAAATAGGCTGG - Intronic
1128386374 15:67151625-67151647 AGGAAAAAGGGAAAATAGCCTGG - Intronic
1128534743 15:68481949-68481971 CACAAAAGGGGGAAATAGAATGG + Intergenic
1129625975 15:77200063-77200085 CTGAACAGGTGGAAATAGGCAGG - Intronic
1130096343 15:80859069-80859091 CAAAAAAAAGGGACATTGGCTGG - Intronic
1130143795 15:81256207-81256229 TAGAAAAAGGGCAAAAAGGCTGG - Intronic
1130936211 15:88472911-88472933 CATAAAAATGTGAAATAGGGTGG + Intronic
1131150384 15:90043869-90043891 AAGAAAAAGGGGAAAAAAGAGGG - Intronic
1131171604 15:90182980-90183002 TAGAAAAATGCGATATAGGCCGG + Intronic
1131795140 15:96008531-96008553 CAAGAAAAGGGGACACAGGCTGG + Intergenic
1131968068 15:97866655-97866677 CAGAAAAGGGGAAAAAAGGAAGG + Intergenic
1132052952 15:98625689-98625711 TATAAAATGGGGTAATAGGCTGG + Intergenic
1132303968 15:100795201-100795223 CAGAAGAAGGTGAAATAAACTGG - Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132894282 16:2220639-2220661 CAGAAAAAGGGACTTTAGGCCGG - Intergenic
1133539958 16:6740640-6740662 CAGAAAAAAGGGAAATATTTAGG + Intronic
1133950765 16:10390484-10390506 TAGAAAAAAAGGTAATAGGCTGG + Intronic
1134076182 16:11293072-11293094 CAGAAAAACGGGAATGTGGCTGG + Intronic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1134850928 16:17478295-17478317 TAGGACAAGGGGAAACAGGCTGG + Intergenic
1135282975 16:21169303-21169325 CAGAAAAAGGGGAAAAAAAAAGG - Intronic
1135607776 16:23837743-23837765 CAGAGAAAGGGGAACTAAGGAGG - Intronic
1135846986 16:25927900-25927922 TAGAAACATGTGAAATAGGCTGG + Intronic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1135979366 16:27135271-27135293 CAGAACAAGGGGGAAAAGGCCGG + Intergenic
1136092300 16:27929225-27929247 CAGAAGAAGGGAGAATGGGCTGG - Intronic
1136158514 16:28402254-28402276 AATAAAAAGGGAAAAGAGGCAGG - Intronic
1136176974 16:28523874-28523896 CAGAAGCAGGGGTTATAGGCTGG - Intergenic
1136204573 16:28713029-28713051 AATAAAAAGGGAAAAGAGGCAGG + Intronic
1136620187 16:31423463-31423485 AAGAAAGAGGAGAGATAGGCGGG - Intronic
1137960791 16:52879999-52880021 CAGATAAATGGGATAAAGGCAGG + Intergenic
1138545633 16:57717876-57717898 CAGGAACAAGGGAAATAGGCAGG - Intronic
1138971160 16:62145285-62145307 CAGAAGAAGGTGGAATAAGCTGG + Intergenic
1139701185 16:68709073-68709095 CAGAAAAACAACAAATAGGCTGG - Intronic
1140068649 16:71630089-71630111 AAAAAAAAAGGGAAAAAGGCTGG + Intronic
1140631986 16:76864435-76864457 CAGAACAAGGTGGAATAAGCTGG + Intergenic
1140940701 16:79719350-79719372 CAGAAATAGGGGCAAAGGGCTGG + Intergenic
1140953530 16:79841466-79841488 GAGAAAAATGGGAAAAAAGCAGG - Intergenic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141872059 16:86793845-86793867 TAGCGCAAGGGGAAATAGGCTGG + Intergenic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1143372321 17:6447985-6448007 CAGAAAATGAGAAAACAGGCTGG + Intronic
1143592280 17:7892789-7892811 TTAAAAAAAGGGAAATAGGCTGG - Intronic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1143875710 17:9989129-9989151 CATTAAAAGTGGAAATGGGCCGG - Intronic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1145050877 17:19659546-19659568 CAAAAAAAGAGAAAATTGGCTGG + Intronic
1146215539 17:30976298-30976320 CAAAAAAAATTGAAATAGGCTGG - Intronic
1146860697 17:36295580-36295602 GTGATAGAGGGGAAATAGGCAGG - Intronic
1146981259 17:37164002-37164024 CAGGTATAGGGGAAACAGGCAGG - Intronic
1147091025 17:38099675-38099697 GTGATAGAGGGGAAATAGGCAGG - Intergenic
1147106186 17:38220829-38220851 GTGATAGAGGGGAAATAGGCAGG + Intergenic
1147408352 17:40230040-40230062 TAAAAAATGGGTAAATAGGCTGG + Intronic
1147759377 17:42787734-42787756 CAAAAAAAGGGGAAATAAAAGGG - Intronic
1147874142 17:43608858-43608880 CACAGAAAGGCTAAATAGGCCGG + Intergenic
1148113202 17:45159036-45159058 AAGAAAAATTGGGAATAGGCCGG - Intergenic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148226663 17:45902944-45902966 CAGAAAACTGGGCCATAGGCTGG - Intronic
1148423320 17:47567687-47567709 GTGATAGAGGGGAAATAGGCAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148941790 17:51220719-51220741 CAGAAACAGGGCAGATACGCTGG + Intronic
1149686632 17:58539299-58539321 CAGAAAAAGGGGATGAAGGTGGG + Intronic
1149726981 17:58905747-58905769 ATTAAAAAAGGGAAATAGGCTGG - Intronic
1150150710 17:62807291-62807313 GAGAAAAAGGGGGAATTGGTTGG + Intronic
1150710576 17:67527706-67527728 CAAAAAAAAGGAATATAGGCTGG + Intronic
1151282785 17:73089086-73089108 CAGAAGAAGGGGGCATAGGAGGG + Intronic
1151539223 17:74756573-74756595 TTGAAAAAGGAAAAATAGGCCGG - Intronic
1152418580 17:80179040-80179062 CTGAAAAATGGAAAATGGGCCGG - Intronic
1152936894 17:83144270-83144292 GAGAAAGAGAGAAAATAGGCAGG - Intergenic
1153674476 18:7444253-7444275 CAAAGAAAGGGAGAATAGGCCGG + Intergenic
1153693472 18:7616647-7616669 GAGACAAAGAGGAAAGAGGCGGG - Intronic
1153720158 18:7893696-7893718 CAGATAAAGGGGAAATAATAAGG - Intronic
1155002074 18:21697367-21697389 TAAAAAAAGGATAAATAGGCTGG - Intronic
1155297911 18:24402186-24402208 CTCAAAAAGGGGCAATAGGCAGG - Intergenic
1155682854 18:28510928-28510950 CTCAAAATGTGGAAATAGGCCGG - Intergenic
1155887532 18:31226270-31226292 ATAAAAAAGGGAAAATAGGCAGG - Intergenic
1155937242 18:31766590-31766612 AAGAAAAAGTGAAAGTAGGCCGG - Intergenic
1156261953 18:35452883-35452905 CAAAAAAAGGAATAATAGGCCGG + Intronic
1156988591 18:43379148-43379170 CAGAAAAACAGGAAATGGGGAGG - Intergenic
1157048529 18:44132568-44132590 CATAAAAAGTAAAAATAGGCTGG + Intergenic
1157155585 18:45262395-45262417 CAGCAAAAGGGGAGTTAGCCAGG + Intronic
1157177377 18:45463946-45463968 CAGAAAAATTAGAAATAGGGTGG - Intronic
1157417844 18:47520933-47520955 TAGAAAGAGGGGAAACAAGCAGG + Intergenic
1157671588 18:49533729-49533751 TATAACAATGGGAAATAGGCTGG + Intergenic
1157672410 18:49541496-49541518 CAAAAATAGAGAAAATAGGCCGG - Intergenic
1157719543 18:49913476-49913498 CAGAGAAAGTGGGGATAGGCTGG - Intronic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1157990396 18:52488943-52488965 GAGAAGAAGGGGGAAGAGGCGGG - Intronic
1159290149 18:66406914-66406936 CTGAAACAAGGGAAATAGGCTGG - Intergenic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1161713211 19:5861631-5861653 CTGAAGAACGGGAACTAGGCAGG - Intergenic
1161771740 19:6234434-6234456 CAGATAAAGGGGAACGAGGTGGG + Intronic
1162346146 19:10119259-10119281 CAGCAAAAGCGGAGAAAGGCAGG + Intronic
1162667370 19:12225280-12225302 CTGAAAAAGGTTAATTAGGCAGG + Intronic
1163472212 19:17504300-17504322 CAGACAAGGGGGAATCAGGCAGG + Intronic
1163478836 19:17542648-17542670 CAGAAATGGGGAAGATAGGCCGG + Intronic
1163693647 19:18751225-18751247 AAGAAAATGGGGAAATGGGCTGG + Intronic
1164459394 19:28434425-28434447 CAGAAAAGTGGGAAAGAGGTGGG + Intergenic
1165990279 19:39807604-39807626 CAGAAAAAGTGAAAATAGCTGGG + Intergenic
1166234767 19:41447543-41447565 CAAAGGAAGGGGAAATAGCCGGG + Intergenic
1166546773 19:43638994-43639016 CAGAGAAGGGGGAAAGAGACAGG + Intronic
1166559558 19:43723134-43723156 CAAAAAAAGAAAAAATAGGCTGG + Intergenic
1166639597 19:44484280-44484302 TAGAAAGTGAGGAAATAGGCCGG - Intronic
1166661878 19:44652676-44652698 CAGAAAAAATAAAAATAGGCCGG - Intronic
1167553401 19:50176893-50176915 AAGATAAAGGAGAAATAGGCTGG - Intergenic
1167873689 19:52394133-52394155 AAGAAAAAGGTCAAAGAGGCCGG - Intergenic
1168028798 19:53663597-53663619 CAGAAATAGGGTAGATGGGCCGG + Intergenic
1168445986 19:56414311-56414333 AAACAAAAGGGGAATTAGGCAGG - Intronic
926260465 2:11255621-11255643 CAGAAAAATGGAAACTAGGCCGG + Intronic
926421989 2:12708781-12708803 CAGAATAAGGTGGAATAAGCTGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926615558 2:14993383-14993405 CAGAAAAAAGGTAAATCAGCAGG - Intergenic
927084788 2:19663813-19663835 TAGAAAATGAGGAAATTGGCAGG - Intergenic
927399211 2:22691270-22691292 CAGAAAAAGAAGAAAAAGGGAGG + Intergenic
928020318 2:27699524-27699546 AAGAAAAAGAAAAAATAGGCCGG + Intergenic
928032404 2:27792728-27792750 CAGAGAAAGGGGGACTTGGCAGG - Intronic
928925212 2:36571707-36571729 TAGATAAAGGGGAAAAAGGCTGG + Intronic
929590410 2:43142165-43142187 TAGAAAAGGGTGAAAAAGGCCGG + Intergenic
929696242 2:44118262-44118284 TAAAAAAATGGAAAATAGGCCGG - Intergenic
929741669 2:44608366-44608388 TACAAAAAAGGAAAATAGGCTGG - Intronic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
932617818 2:73246642-73246664 AAGAGAGAGGGGAAGTAGGCAGG - Intronic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933124253 2:78584470-78584492 CATGAAAATGGGAAATAGGTTGG - Intergenic
933818887 2:86091815-86091837 CAATAAAAGTAGAAATAGGCCGG + Intronic
934571102 2:95373970-95373992 CTGAACAAGGGGATATAGGAGGG - Intronic
935218423 2:100992115-100992137 CCAAATAAGTGGAAATAGGCTGG + Intronic
936704228 2:115052653-115052675 AAGAAAAATGGAAAACAGGCCGG + Intronic
938120863 2:128632162-128632184 CAGAAAGAGGGGAGAAATGCTGG - Intergenic
938601276 2:132842834-132842856 CAGAAAAAATGGAAATTGGGTGG - Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
939775612 2:146383925-146383947 AAATCAAAGGGGAAATAGGCAGG + Intergenic
939957403 2:148538479-148538501 GAACAAAATGGGAAATAGGCAGG + Intergenic
940078539 2:149772251-149772273 TAGAAAATAAGGAAATAGGCCGG + Intergenic
940230140 2:151442367-151442389 TAAAAAAAAGGGAAATATGCTGG - Intronic
940262502 2:151796301-151796323 AAGAAAAAAGGGAAAAAAGCAGG - Intronic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940594189 2:155768493-155768515 CAGGAAAAGGGGTAAAAGGAAGG - Intergenic
940653351 2:156459388-156459410 ATGAAAAAGGGAATATAGGCTGG + Intronic
941009341 2:160281615-160281637 GAGAAAAAGGCGAAACAGACTGG + Intronic
941197319 2:162468841-162468863 AAAAAAAAAGGGAAAGAGGCTGG - Intronic
941375520 2:164724087-164724109 CAGAAAAAGGTAGAATAGGCTGG - Intronic
941529041 2:166641875-166641897 CAGAAAAATGGAACATAGTCTGG - Intergenic
942462700 2:176179246-176179268 GGGTAAAAGGGGAACTAGGCTGG - Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
942739803 2:179162689-179162711 TAGAACAAAGGCAAATAGGCTGG + Intronic
944065446 2:195615063-195615085 CAAAAAAAGGGAAAATAGAGGGG + Intronic
944408036 2:199407651-199407673 CAGATAAAATGGAAATAGGTGGG - Intronic
945083884 2:206112053-206112075 CATAAAAAGAGAAAACAGGCTGG - Intergenic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
945652921 2:212586727-212586749 TAGAAAGAGGAGAAATATGCAGG + Intergenic
946220907 2:218225996-218226018 ATGAAAAATAGGAAATAGGCTGG + Intronic
946273631 2:218614445-218614467 AATAAAAAGAGGAAAAAGGCTGG - Intronic
946313578 2:218896059-218896081 AGGAAATAGGGGAAATGGGCTGG + Intronic
946350158 2:219145635-219145657 TAGAAAATGGGGCAATAGGCCGG + Intronic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948611807 2:239174344-239174366 CAGAAAAATGGGCAAGAGACTGG + Intronic
948626292 2:239270520-239270542 CAGAATAAGCTGAAATAGTCCGG + Intronic
1168731132 20:82021-82043 TAAAAGAAGGAGAAATAGGCTGG + Intergenic
1169188601 20:3642161-3642183 CACAAGAAGGGGACAAAGGCAGG - Intronic
1169216781 20:3798767-3798789 AAGAAAAACGGGACATACGCTGG - Intronic
1170767562 20:19303814-19303836 CACAAAAATGGGAGATAGGAAGG - Intronic
1170799123 20:19575914-19575936 CAGAAAAAGTGGAGATGGGGTGG + Intronic
1171950579 20:31417962-31417984 TCGAAAAAAGGGAAAAAGGCCGG + Intergenic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172259912 20:33554543-33554565 AAGAAAAAAGAAAAATAGGCCGG - Intronic
1172270442 20:33652760-33652782 CAGAAAGAGAGCAAAGAGGCCGG + Intergenic
1172488724 20:35316932-35316954 CAAAAAAAAAGGAAATGGGCCGG - Intronic
1173618223 20:44416583-44416605 CAGAAAAAGAGGAAACTGCCTGG - Intronic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174244357 20:49165337-49165359 CAAAAAAAGAAAAAATAGGCCGG - Intronic
1174827930 20:53785686-53785708 CAGAAAAAGGTGTATTTGGCAGG - Intergenic
1175854822 20:62114994-62115016 CAGGAAACTGGGGAATAGGCAGG - Intergenic
1177523644 21:22264655-22264677 CATTAAAAATGGAAATAGGCTGG + Intergenic
1177689280 21:24482898-24482920 TAGAAAAGGGAGAAATAGACCGG - Intergenic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178517165 21:33257809-33257831 CTGGAAAAGGGGACATGGGCAGG + Intronic
1179126900 21:38598956-38598978 AAGGAAAGGGGGACATAGGCAGG + Intronic
1179876326 21:44270455-44270477 AAAAAAAAGAGGAAAGAGGCCGG - Intergenic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181886013 22:26023003-26023025 AACAAAAAGGCGAGATAGGCTGG - Intronic
1181977338 22:26740263-26740285 TAGAAAAAGGTGAAATATGGAGG - Intergenic
1182094682 22:27618056-27618078 AGGAAAAAGGGGAAATAGGGAGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182334332 22:29573359-29573381 CATAAAAATGAGAAATGGGCCGG + Intronic
1182534094 22:30987147-30987169 CAGAAACAGCAGAATTAGGCCGG - Intergenic
1182588612 22:31361940-31361962 CAGCAAAGGGGAAAACAGGCTGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183288501 22:36982916-36982938 AAGAACAAGAGGAAAAAGGCTGG - Intergenic
1183924114 22:41193550-41193572 CAGAAAAAAGGGTAACAGCCGGG + Intergenic
1183963061 22:41424266-41424288 CACAAGAAAAGGAAATAGGCTGG - Intergenic
1184223078 22:43112905-43112927 CAAAAAAAGGAGCATTAGGCTGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184819212 22:46896182-46896204 AAGAAAAATGGGCAAAAGGCAGG - Intronic
1185039553 22:48497355-48497377 CAGAAACAGGGGCAAGGGGCTGG - Intronic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
949350259 3:3118672-3118694 CATAAAAATAGGAATTAGGCTGG - Intronic
949976055 3:9460877-9460899 GAGACAAAAGGAAAATAGGCTGG + Intronic
950855248 3:16098517-16098539 GAGCAAAAGGGGAAAAAGGATGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952023261 3:29048479-29048501 TAGAAAAACGGGAAATGGACTGG - Intergenic
952765722 3:36952473-36952495 TAGAAAAGTGGGAAATGGGCCGG - Intergenic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
955233066 3:57115925-57115947 CATAAAAATGGGAAATGTGCAGG - Intronic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
957027251 3:75195831-75195853 CAGAACAACGTGAAATAGGGAGG - Intergenic
957785176 3:84873511-84873533 TAGAAAAAGGAGTATTAGGCTGG + Intergenic
957825886 3:85443412-85443434 CAGAGAAATGGGAATGAGGCTGG - Intronic
957960328 3:87241464-87241486 CAGGAAAAAGGGAGACAGGCAGG - Intronic
958812391 3:98876376-98876398 CAGAAAAACGGGCAAAAGACAGG + Intronic
959913130 3:111787661-111787683 AGGAAAAAGAGGAAAAAGGCAGG - Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960404761 3:117246134-117246156 CAGAAAAAGGAGAAATAAATGGG - Intergenic
960616489 3:119600482-119600504 CGGAGAAAGGGAAAATAAGCAGG - Intronic
960654833 3:119991032-119991054 CAGAACAAGTGAAACTAGGCAGG + Intronic
961925323 3:130473431-130473453 CAGAAAAGGGGGAAAAAAGCAGG - Intronic
962910086 3:139840134-139840156 CAGAAAAGGGGAAAATTGGGAGG + Intergenic
963562356 3:146881839-146881861 CAGAAACAGTTGAAAGAGGCTGG + Intergenic
963969869 3:151417764-151417786 CTTAAAAATGGGGAATAGGCCGG - Intronic
964584286 3:158279451-158279473 TACAAAAACAGGAAATAGGCTGG + Intronic
964721887 3:159775522-159775544 GAGAGAAAGGCGAAACAGGCAGG - Intronic
965327813 3:167329520-167329542 CAGAAAAAGGTGCAAGAAGCAGG + Intronic
965783525 3:172313061-172313083 GAGAAAAAGGGGAAAGAAGAGGG - Intronic
965938051 3:174139623-174139645 AATAAAAAGGGGAAAAATGCTGG + Intronic
966035473 3:175408107-175408129 CAGAAACAGGGGAAAGGGGAAGG + Intronic
966171780 3:177089725-177089747 CAGAACAAGAGGAAATAGAAGGG + Intronic
966293750 3:178392722-178392744 CACAAAAACAGGAATTAGGCTGG + Intergenic
966685271 3:182686609-182686631 AATAAAAGGGGGAAATGGGCTGG + Intergenic
967069752 3:185952475-185952497 CAGAGAAAGGGAGAAGAGGCGGG + Intergenic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
968004285 3:195228782-195228804 AAGAAATAAGGGAAATAGGCCGG - Intronic
968318502 3:197744987-197745009 AAGAAAAGGGGGATTTAGGCTGG + Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968790197 4:2655024-2655046 CAAAAAAAGGGGACAAATGCTGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
970796939 4:19924115-19924137 ATCAAAAAGGGGAAATGGGCTGG + Intergenic
971030116 4:22627095-22627117 CAGAAAAAGGGAAAATAAATGGG - Intergenic
971304523 4:25467983-25468005 TTGAAATAGGAGAAATAGGCCGG + Intergenic
971821845 4:31567209-31567231 GAGAAGAGGGGGAAATAGGGAGG + Intergenic
973011665 4:45083002-45083024 TAGAATCAGAGGAAATAGGCCGG - Intergenic
973572224 4:52252312-52252334 CAAAGAAAGGGCAGATAGGCAGG + Intergenic
974453848 4:62100782-62100804 CAGGAAAATGGGAATTAGGGAGG - Intergenic
974502298 4:62722206-62722228 AAGAATAAGAGGAAATAGGTTGG - Intergenic
974567854 4:63601642-63601664 TAGAAAAAAGAAAAATAGGCCGG + Intergenic
975110879 4:70625076-70625098 TAGAAAAAAGGAAACTAGGCCGG - Intergenic
975131086 4:70833813-70833835 TATGAAAAGGGGAAAAAGGCTGG - Intronic
975215711 4:71751666-71751688 AAGAAAAAGGGGAGACAGGGAGG + Intronic
976232817 4:82863174-82863196 AAGAAAAAGGGAAAAAACGCTGG + Intronic
976692588 4:87884520-87884542 AAGAAAAAGGGAAAATAAGGTGG + Intergenic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
979277969 4:118835020-118835042 CTGAAAAAGAGGAGAGAGGCAGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
981311848 4:143305145-143305167 TAGAAAATGAGGCAATAGGCTGG + Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
981995860 4:150974687-150974709 CAGACAAACTGGAAAAAGGCAGG + Intronic
982358866 4:154497251-154497273 CAGAAAAGGGGAAATTAGGCAGG - Intergenic
982396885 4:154923423-154923445 CAGAAAAGTGGGAAAGGGGCCGG + Intergenic
983708863 4:170690060-170690082 CAAACAAAGGAGCAATAGGCAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984709107 4:182870051-182870073 AAGAAAAAGAGGAAATAGGAGGG - Intergenic
985038667 4:185866882-185866904 CAGAACAAGGGAATAAAGGCAGG + Intronic
985102605 4:186473661-186473683 AAAAAAAAGGGGAAATAGCAGGG + Intronic
986636048 5:9823560-9823582 CAGAAAGGGGGGAAAGAGGAAGG + Intergenic
986825083 5:11511641-11511663 CATATAAAGGGGAAATTAGCAGG - Intronic
987109198 5:14669065-14669087 GAGAAAATAGGTAAATAGGCCGG + Intronic
987183695 5:15392526-15392548 TAGAAAAAGGAGAAATCGGCCGG + Intergenic
987879201 5:23719696-23719718 TAGAAAAAGTACAAATAGGCTGG - Intergenic
987887179 5:23827944-23827966 CAGCAAAAAGGAAAATAGGCTGG - Intergenic
988464545 5:31475892-31475914 CAGATAAAAGGGAAATGGACTGG + Intronic
989792888 5:45428787-45428809 CAGAAAAAGCTGAAATAGCAAGG + Intronic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990677849 5:58208390-58208412 AAGAAACAGGGGATATAGGATGG - Intergenic
990682772 5:58264349-58264371 CAGCAAAAGGGAAAATAGCAAGG + Intergenic
991520821 5:67494940-67494962 AAGAAAAAGTGGAAACAGGCTGG + Intergenic
991655327 5:68898484-68898506 CAGAAGCAGGGGAAATAGAGAGG - Intergenic
991680122 5:69131756-69131778 TTGAAAAAGGCTAAATAGGCCGG + Intergenic
992672244 5:79071968-79071990 TAGAAAAATGGCAAATTGGCCGG + Intronic
992998632 5:82357501-82357523 CGGAAACAAGGGAAATAGTCTGG + Intronic
993121338 5:83778380-83778402 GAGAATAAGGGGAAAAAGGTGGG + Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993434633 5:87876906-87876928 TAGAAAAAGAGGAAATAGATGGG - Intergenic
993676936 5:90826935-90826957 CAGGAAAAGGGGAAATGGACTGG - Intronic
994997103 5:107078153-107078175 GAGAAAAAATAGAAATAGGCCGG + Intergenic
995871774 5:116750637-116750659 CACAAAATGGTGAGATAGGCAGG + Intergenic
996576612 5:124983079-124983101 CAGAAAAAGGCGTAACAGGCTGG - Intergenic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997923563 5:138006191-138006213 AAAAAGAAGAGGAAATAGGCCGG - Intronic
998638799 5:143986464-143986486 GAGAAAATGGGGTTATAGGCTGG - Intergenic
998722824 5:144974297-144974319 CAGGAAAGAGGGAAAAAGGCTGG + Intergenic
1001331623 5:170766568-170766590 CAGAAAAGTGGGAAAGAGGTTGG + Intronic
1001421436 5:171590201-171590223 GAGAAAAAAGGGAAGTAGGAAGG - Intergenic
1001695900 5:173669598-173669620 CAGAAAAAGAGGAAAGAAGGAGG - Intergenic
1001786168 5:174415652-174415674 CTCAAAGTGGGGAAATAGGCAGG + Intergenic
1003508920 6:6763079-6763101 CAGAAAAAGAAAAAATATGCTGG + Intergenic
1003553185 6:7117311-7117333 CAGAAATAGGGGAGATAACCAGG + Intronic
1004333110 6:14739641-14739663 AAGAAAAATGGGATATAGTCAGG + Intergenic
1004589449 6:17034910-17034932 CAGAAAGAGGGCAAATGGGGTGG - Intergenic
1004981802 6:21032367-21032389 GAAATAAAGGGGAAATAGCCAGG - Intronic
1005047162 6:21653401-21653423 CAGGAAAAGGTGGAATAAGCTGG + Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005621258 6:27622672-27622694 CAGAAATTGTGGACATAGGCCGG + Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006725046 6:36193277-36193299 CAGGCAAAGGGAAAATATGCAGG - Intergenic
1006768518 6:36530661-36530683 AAGAAAAAAAGGAAAAAGGCCGG - Intronic
1006803580 6:36774694-36774716 CAGACAGAGGGGAAAGAGGTGGG + Intronic
1007795167 6:44341336-44341358 CAGAAAAAGGGTAGAGAGGAAGG + Intronic
1007987101 6:46217874-46217896 CAGAAAAAGGGGAACAGAGCAGG - Intergenic
1009886728 6:69632117-69632139 TAGAAAAAGAGGAAAGATGCAGG + Intergenic
1010420486 6:75669051-75669073 AATAATAAGGGAAAATAGGCCGG + Intronic
1010581702 6:77607045-77607067 AAGACCAAGGGGAAATGGGCAGG - Intergenic
1010921810 6:81691816-81691838 GAGAATAAGTGGAAATAAGCTGG + Intronic
1010994954 6:82522848-82522870 CAGAAAAAGAGGACACATGCTGG + Intergenic
1011130755 6:84049787-84049809 CAGGAGAAGGGGGGATAGGCAGG + Intronic
1012657051 6:101837560-101837582 AAGAAAAAGGGAAAATAGTCTGG + Intronic
1012742741 6:103040432-103040454 TAGAAAAGGTGGAAATAGACAGG - Intergenic
1013949698 6:115764837-115764859 AAGAAATAGGCAAAATAGGCCGG + Intergenic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1015102376 6:129496460-129496482 CAAAAGAAGGGGAAATAGGCCGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015735932 6:136400118-136400140 AAAAAAAGGGGAAAATAGGCTGG + Intronic
1016020073 6:139228217-139228239 CTTAAAAAGGGAAACTAGGCTGG + Intergenic
1016244764 6:141968672-141968694 CAGAAGAAGGTGGAATAAGCTGG + Intergenic
1016594482 6:145784006-145784028 CAGGAAAAGGGTTAAGAGGCGGG - Intergenic
1016946724 6:149541713-149541735 TATAAAAAAGGGCAATAGGCCGG + Intronic
1017096888 6:150812567-150812589 CAGAAAAAGGGGGATTAAGAAGG + Intronic
1018273030 6:162101092-162101114 CAACAAAAGGGAAAATAGGTGGG - Intronic
1018719269 6:166560623-166560645 CAGAAAAAAGAGAAATGGGGTGG + Intronic
1019579716 7:1755110-1755132 TAGAAAATGGGAAAAAAGGCTGG - Intergenic
1019861302 7:3660440-3660462 AAGAGAATGGGGAAATAGGAGGG + Intronic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020146164 7:5645109-5645131 CAGAAAATAGGCAAACAGGCGGG - Intronic
1020376528 7:7493658-7493680 AAGAAAAAGGGGAAATGGGAAGG - Intronic
1020435840 7:8161561-8161583 GAGAGAAAGTGGAAACAGGCTGG - Intronic
1020473860 7:8571408-8571430 CAGGAAAAGGGGAAATTTGGGGG + Intronic
1020534147 7:9372999-9373021 CAGAAACAGGGGAAGTGGGAGGG - Intergenic
1021330147 7:19327199-19327221 CAGAAAAAGAGGAAATTGAATGG - Intergenic
1021499709 7:21319050-21319072 CAGAGAGAGGGGAAATGGGGTGG - Intergenic
1021724395 7:23535202-23535224 TAGAAAAATGGAAAATAGGCCGG - Intergenic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1023159754 7:37285673-37285695 CAAAAGAAGGGGAAAAAAGCAGG + Intronic
1023427687 7:40056419-40056441 CAGAGAAAGGGGATAAAGCCAGG - Intronic
1024094132 7:45970998-45971020 CAGAAATAGGAGAAACAGACTGG - Intergenic
1025065500 7:55851710-55851732 CAGAAATAGAAAAAATAGGCCGG + Intronic
1026060559 7:67021909-67021931 AAGAAAAACAGGCAATAGGCTGG - Intronic
1026241561 7:68579907-68579929 AAGAAAAAGGTAAAATAGGGAGG - Intergenic
1026285041 7:68955400-68955422 CAGAGAAAAGGGGAAGAGGCAGG + Intergenic
1026375098 7:69742097-69742119 AAAAAAAAGGTAAAATAGGCTGG - Intronic
1027057249 7:75058231-75058253 AAAAAAAAGAGCAAATAGGCTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1028544783 7:91985941-91985963 TAGAAAAAGGGGGAATTGGCTGG - Intronic
1028825153 7:95263709-95263731 TAGAAAAACTGGAAAGAGGCCGG - Intronic
1029269493 7:99368492-99368514 AAAAAAAAGGCAAAATAGGCCGG - Intronic
1029650436 7:101887602-101887624 CAGAAAAAGAGGACATGGCCGGG - Intronic
1030229528 7:107192666-107192688 CAGAAAAGCAGGAATTAGGCAGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1031283742 7:119839050-119839072 CAGAAGAAGTGAAAATAGCCAGG - Intergenic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032527356 7:132588871-132588893 AAGAAAAGGGGGAAAGAGGTAGG + Intronic
1032654706 7:133915319-133915341 AGGAAAAAGGGGAGATAGGTCGG + Intronic
1033894923 7:146057539-146057561 AAGAAACAGGGGAAACAGGGAGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035452849 7:158989618-158989640 AAGAACAGTGGGAAATAGGCTGG + Intergenic
1035884888 8:3281144-3281166 AAGAAAATGGGTAAACAGGCTGG + Intronic
1036612550 8:10362781-10362803 CCGACAAAGAGGAAAAAGGCAGG - Intronic
1037307002 8:17515587-17515609 CAGAAAAATGGCAATCAGGCAGG - Intronic
1037572996 8:20174207-20174229 CAGAAATAAGGGAATTGGGCTGG - Intronic
1037706165 8:21316910-21316932 CAGAAAAAGAGGAGATTGGCAGG + Intergenic
1037859107 8:22392224-22392246 CAGAAGATGGGGAACTAGGAAGG + Intronic
1037999752 8:23381636-23381658 TAGAAAAAGGGGTATAAGGCAGG - Intronic
1038313136 8:26461369-26461391 CACAAAAAGTGCAATTAGGCTGG + Intronic
1038804757 8:30780084-30780106 CAGAAAAAGAGGAAATAAATGGG + Intronic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039662540 8:39482872-39482894 AACAAAAAGGGGAAAAAGGGAGG - Intergenic
1040104467 8:43533804-43533826 AAGAAAAAGGGAAAACAGGAGGG - Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041681153 8:60593429-60593451 CAGAGAACCAGGAAATAGGCAGG + Intronic
1042848546 8:73192382-73192404 CTGAAAAATGGGAAAATGGCTGG + Intergenic
1042914970 8:73866751-73866773 CAGAAAAAAAGTAAATTGGCTGG + Intronic
1043719701 8:83532392-83532414 CAGAAAAACAGGAATTAGGGAGG - Intergenic
1044113117 8:88301275-88301297 CAGAAAAAGAGGAAATGAGGAGG - Intronic
1044439869 8:92210224-92210246 AAGAGAAATAGGAAATAGGCGGG - Intergenic
1044590818 8:93913149-93913171 CAGTCACAGGGGAAAGAGGCTGG - Intronic
1045853708 8:106736300-106736322 TAGAAAAAAGGAAAAGAGGCTGG - Intronic
1046059559 8:109120921-109120943 CATAAAATAGGGATATAGGCTGG - Intergenic
1046694665 8:117326184-117326206 GAGAGAAAGGGGAAATTGGCTGG + Intergenic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1047765987 8:127990291-127990313 CAGCAATAGGGGGAATGGGCAGG - Intergenic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1049024335 8:139978534-139978556 GAGGAAATGGGGAAATAGGTAGG + Intronic
1049104115 8:140600779-140600801 CAGAGAGAGGGGACATAGGACGG - Intronic
1050053206 9:1624450-1624472 CAGAAGAAGGTGAAATAAGGTGG + Intergenic
1050118251 9:2282440-2282462 CAGAAAAAGGATATCTAGGCAGG + Intergenic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050694050 9:8259777-8259799 TAGAAAAATGGGAAAGATGCTGG - Intergenic
1050909489 9:11050118-11050140 CAGAAAAAGTGGAAAAAGTGAGG - Intergenic
1050956719 9:11671045-11671067 CAGAAATAGGGTTAATATGCAGG - Intergenic
1051640905 9:19223774-19223796 CAGAGAAAGGAGTAATGGGCAGG - Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1051979850 9:23000518-23000540 CAGAGAAAAGGGTAATATGCAGG + Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052538297 9:29776107-29776129 AAGGAAAAGGGGAAATATGTGGG - Intergenic
1052821945 9:33144532-33144554 CAGAAAAAGAGAAAATGGGCTGG - Intronic
1052838820 9:33273454-33273476 CAGGAAAAGGATAATTAGGCAGG - Intronic
1052909961 9:33872006-33872028 AAGAAATACAGGAAATAGGCCGG - Intronic
1053242228 9:36505333-36505355 AAGAAAAAGTGAAAATTGGCTGG - Intergenic
1055177337 9:73336266-73336288 GAGAAAAAGGGGGAAAAGGAAGG - Intergenic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055303306 9:74904188-74904210 AAAAACCAGGGGAAATAGGCTGG - Intergenic
1057308965 9:93929665-93929687 TAGAAAAAGGGGAAATTGCCAGG + Intergenic
1058375924 9:104321353-104321375 TAGAGAAAGGGGAAATGGTCAGG + Intergenic
1058600308 9:106661888-106661910 CAGTCATAGGGGAAATAGTCAGG + Intergenic
1058690081 9:107512585-107512607 AAGAAAAAAGGAAAAAAGGCTGG + Intergenic
1059550043 9:115220097-115220119 AGAAAAAAGGGGAAACAGGCTGG + Intronic
1059777377 9:117489054-117489076 CAGAAGAAGAGGAACTGGGCTGG - Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1059990372 9:119859715-119859737 GAGCAAAAGGGGAAATAAGGAGG - Intergenic
1060621539 9:125071719-125071741 CAGTGAAAGGGAAAAAAGGCAGG + Intronic
1060738053 9:126079195-126079217 CAGAAAAATGGGAAAGGGGTTGG + Intergenic
1060763563 9:126276143-126276165 CAGACAAAGGGGAAATGAGGTGG - Intergenic
1061081434 9:128373074-128373096 CAGAAAAAGGGCAATTGTGCTGG - Intronic
1061196377 9:129109348-129109370 GAGAGAAACAGGAAATAGGCAGG - Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061358358 9:130123496-130123518 AAGAAAAAAAAGAAATAGGCCGG - Intronic
1061676121 9:132216756-132216778 CAGAAGAAGGGGAAATATCTGGG + Intronic
1061746636 9:132745056-132745078 TGGAAGAAGGGGAAATAGGTGGG - Intronic
1186746146 X:12571443-12571465 AGGAGAAAGGGGAAACAGGCAGG - Intronic
1187063622 X:15811720-15811742 CAACAAAAGGAGAATTAGGCCGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1187282950 X:17875571-17875593 CAGAAAAAGAGGAAAAAGAGTGG - Intergenic
1187294102 X:17982575-17982597 CAGAAAAAGTGGAAAACAGCTGG - Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188281903 X:28280844-28280866 CAGAAAAAGGAGAAATAAATAGG - Intergenic
1188521095 X:31038823-31038845 AAGGAAAAGGGGAAACAGACTGG - Intergenic
1189763881 X:44349274-44349296 AAGACAAAGAAGAAATAGGCCGG - Intergenic
1190666795 X:52703814-52703836 TAGAAAAACTGCAAATAGGCCGG + Intronic
1190672623 X:52754594-52754616 TAGAAAAACTGCAAATAGGCCGG - Intronic
1190748418 X:53340713-53340735 CACAAAAATGAGAAAAAGGCTGG + Intergenic
1193369119 X:80672310-80672332 AAGAATAAGGGTATATAGGCCGG + Exonic
1193536056 X:82716675-82716697 TATAAAAATGGGAACTAGGCTGG - Intergenic
1194180117 X:90700605-90700627 CAGAAGAAGGTGGAATAAGCTGG - Intergenic
1194651684 X:96522752-96522774 AAGAAAAAAGGTAAAGAGGCCGG + Intergenic
1195329463 X:103785553-103785575 AAGAAGAAGGGGAAACAGTCAGG - Intronic
1195601652 X:106755726-106755748 CTAAAAAAGGGCAATTAGGCAGG + Intronic
1195747822 X:108136359-108136381 AAGGAAAGGGAGAAATAGGCAGG + Intronic
1196037920 X:111167302-111167324 GAGGAAAAAGGGAAACAGGCAGG + Intronic
1198039306 X:132834085-132834107 CCTAAAAAGGTGACATAGGCAGG + Intronic
1198521874 X:137461229-137461251 CAGAAATAGAGAAAAGAGGCTGG + Intergenic
1198859815 X:141057054-141057076 GAGATAAAGAGGAACTAGGCTGG - Intergenic
1198879475 X:141263701-141263723 AAGAAAAAGAGAAAATTGGCTGG - Intergenic
1198902878 X:141530336-141530358 GAGATAAAGAGGAACTAGGCTGG + Intergenic
1199061392 X:143359249-143359271 CTGAAAAATGGGAAACAGGCTGG + Intergenic
1200203872 X:154301887-154301909 AAGAAAATGGGGACTTAGGCCGG - Intronic
1200526774 Y:4282773-4282795 CAGAAGAAGGTGGAATAAGCTGG - Intergenic
1200734858 Y:6783077-6783099 AAGTAAAAAGGGAAATAGGGGGG + Intergenic
1201431624 Y:13908546-13908568 GAGAAAATGGGGAAAGAGGAAGG - Intergenic
1201521950 Y:14885065-14885087 TAGAAAAAGAGGGAATAGGCCGG - Intergenic
1201636868 Y:16133067-16133089 TTGAAAAAGGTTAAATAGGCAGG - Intergenic