ID: 1070038284

View in Genome Browser
Species Human (GRCh38)
Location 10:72749522-72749544
Sequence CAAACACAAGTCCCTATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070038284_1070038287 13 Left 1070038284 10:72749522-72749544 CCTATTATAGGGACTTGTGTTTG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1070038287 10:72749558-72749580 CTATGTCTTGGTGATAGATAAGG No data
1070038284_1070038286 1 Left 1070038284 10:72749522-72749544 CCTATTATAGGGACTTGTGTTTG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1070038286 10:72749546-72749568 AAGGACTGCTTTCTATGTCTTGG No data
1070038284_1070038288 26 Left 1070038284 10:72749522-72749544 CCTATTATAGGGACTTGTGTTTG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1070038288 10:72749571-72749593 ATAGATAAGGATTAAAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070038284 Original CRISPR CAAACACAAGTCCCTATAAT AGG (reversed) Intronic
901418828 1:9136498-9136520 CAATCACAAGGTCCTACAATAGG + Intergenic
903649430 1:24913866-24913888 CCAACACAAGCCCCTGTCATAGG + Intronic
906812079 1:48837618-48837640 CAATCACAAGGCCCCACAATAGG - Intronic
906867986 1:49443531-49443553 AAAACACAAGAGCTTATAATGGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909110885 1:71475966-71475988 CAAACACATGTTACTATGATAGG - Intronic
910060817 1:83089621-83089643 CAATCACAAGATCCCATAATAGG + Intergenic
911109435 1:94166872-94166894 CAAACACAAGGTCCCACAATAGG + Intronic
918064722 1:181091864-181091886 AAAACAGAAGTTCGTATAATTGG - Intergenic
918475953 1:184925331-184925353 AAAACACAAGACCCAATGATTGG - Intronic
921352079 1:214246235-214246257 CAATCACAAGTTCCCACAATAGG + Intergenic
921677960 1:217997851-217997873 CAGACACAGGTGCCTATAATAGG - Intergenic
921859341 1:220025343-220025365 TAAACAAAAGTCCTTCTAATTGG + Intronic
1066179551 10:32946712-32946734 AAAACACAAGTGCCAATAAGTGG + Intronic
1067765624 10:49083795-49083817 CAAAAACAAGACCATATATTTGG - Intronic
1070038284 10:72749522-72749544 CAAACACAAGTCCCTATAATAGG - Intronic
1071692741 10:87839549-87839571 GAAGGACAAGTCCTTATAATTGG + Intronic
1072116251 10:92373026-92373048 CAATCACAAGGCCCCACAATAGG - Intergenic
1072290782 10:93962571-93962593 CAATCACAAGGCCCCACAATAGG + Intergenic
1073013215 10:100377732-100377754 CAAATAAAAGACCCTAGAATGGG + Intergenic
1078397746 11:10996408-10996430 CAAACACCTGTCACTATAGTTGG - Intergenic
1078777667 11:14408658-14408680 CAATCACAAGTTCCCACAATAGG - Intergenic
1079655896 11:22986572-22986594 CAATCACAAGTTCCCACAATAGG + Intergenic
1079793924 11:24774279-24774301 CAATCACAGGGCCCCATAATAGG - Intronic
1083027127 11:59560279-59560301 CAAACAAAAGATCCTAAAATTGG + Intergenic
1085112342 11:73899007-73899029 CAAACACAAGTCCTTTTGTTGGG + Intronic
1085916277 11:80891894-80891916 CAGACAGAATTCCCTTTAATAGG - Intergenic
1086993898 11:93334743-93334765 CAAATACAAACACCTATAATTGG - Intronic
1090730021 11:129564432-129564454 CAATCACAAGGCCCCACAATAGG + Intergenic
1095594504 12:43943626-43943648 CAAACACAAGTGCATATGAGAGG - Intronic
1096050602 12:48604324-48604346 CAATCACAAGGTCCCATAATAGG - Intergenic
1097889448 12:64762279-64762301 AAAACCCAAGTCCTTAAAATAGG - Intergenic
1098204275 12:68091009-68091031 CAAATACAAGTTACTAAAATTGG - Intergenic
1099942196 12:89201938-89201960 CAAACACAGCTCCCTAGAATAGG + Intergenic
1100085378 12:90904025-90904047 CATTTACAAGTTCCTATAATTGG - Intergenic
1100731729 12:97478583-97478605 CAAACACCAGTGAGTATAATTGG + Intergenic
1101542667 12:105679029-105679051 CAATCACAAGTTCCCACAATAGG - Intergenic
1107490045 13:40872946-40872968 CAATCACAAGGTCCCATAATAGG - Intergenic
1109082787 13:57927791-57927813 CAAATAAGAGTCCCCATAATGGG + Intergenic
1112380061 13:98880427-98880449 CAAACACCACTCCCTAAAAAGGG - Intronic
1112713840 13:102160711-102160733 AAACCAAAAGTCCCTAGAATAGG + Intronic
1112990276 13:105505257-105505279 CGAACACAAGACCCCACAATAGG + Intergenic
1113521089 13:110941564-110941586 CCAACACATGTCCCCATAAGAGG - Intergenic
1114703227 14:24699899-24699921 CAAACACATGTGACTATAACTGG - Intergenic
1117736173 14:58771094-58771116 CACCCCCAAATCCCTATAATTGG + Intergenic
1120594358 14:86415740-86415762 CAATCACAAGGTCCAATAATAGG + Intergenic
1124332686 15:28833783-28833805 CAAACACAAGACCTCATAAAAGG - Intergenic
1124987104 15:34630902-34630924 CAATCACAAGGCCCCATAATAGG + Intergenic
1125000148 15:34761090-34761112 TACACACATGGCCCTATAATGGG - Intergenic
1126650805 15:50919706-50919728 CAGATACACGTCCCTCTAATTGG - Intronic
1127327725 15:57911815-57911837 CAAACAGAAGTGCTTATAAAAGG + Intergenic
1131313499 15:91311951-91311973 CAAACAGAAGTCTCTATAAATGG + Intergenic
1131686914 15:94778107-94778129 TAAACATAACTCCCTATACTTGG + Intergenic
1135915979 16:26605841-26605863 CAAACACATGTCCGTTTATTAGG - Intergenic
1137534419 16:49307371-49307393 CAAATACAAGTCTCTGTATTGGG + Intergenic
1137730465 16:50686010-50686032 CAAACAGATGTCCCAAGAATGGG - Intergenic
1138429954 16:56962327-56962349 CAAACACAAATCCCTATACCTGG - Intronic
1139822466 16:69731346-69731368 CAATCACAAGGCCCCACAATAGG - Intergenic
1140150286 16:72356303-72356325 GAAACACATATCCCTATAATGGG + Intergenic
1141257622 16:82417400-82417422 CAAATCCAAGTGTCTATAATAGG + Intergenic
1144889680 17:18487505-18487527 CACACACACGTCCCTGTAACTGG + Intronic
1145142531 17:20456791-20456813 CACACACACGTCCCTGTAACTGG - Intronic
1145802201 17:27694895-27694917 CAAACCCAATTCCCTTTGATAGG - Intergenic
1156047199 18:32890134-32890156 CTAAGAGAAGTCCCTATAAAAGG + Intergenic
1156606104 18:38668978-38669000 CAATCACAAGTTCCCACAATAGG - Intergenic
1157246637 18:46060637-46060659 CAATCACAATTCCCTCTAAATGG + Intronic
1157746071 18:50136931-50136953 AATACACAAGTGCCTATAACAGG - Intronic
1158313957 18:56189997-56190019 AAAACGCAAGCCCCTATAAAGGG + Intergenic
1166578930 19:43874862-43874884 GAAAAACAAGTCCCTACCATTGG + Intronic
1168663618 19:58185777-58185799 CAAACAGAAGTCCCTGTACAGGG + Intronic
926163193 2:10502300-10502322 CAAGCACAAGTCCCTAAAGGGGG - Intergenic
929593145 2:43159855-43159877 CAAACAGAAGTCACTACAACGGG - Intergenic
930537008 2:52655704-52655726 CAATCACAAGTTCCCACAATAGG + Intergenic
930562589 2:52979306-52979328 CAGACCCAAGTCCCTCTAGTCGG - Intergenic
930975525 2:57454852-57454874 CAAATTCAATTTCCTATAATAGG - Intergenic
931023692 2:58082445-58082467 CAAAGACAAGTGCCTAAAGTAGG + Intronic
932655220 2:73605110-73605132 CAAACACAAGTCAGAATAATTGG - Intronic
932663369 2:73676713-73676735 TAAACACAAGTCAGAATAATTGG - Intergenic
935122821 2:100197319-100197341 CACACATAAATCCCTTTAATAGG - Intergenic
936166319 2:110122753-110122775 CAAAAAAAAGTACCTCTAATGGG + Exonic
937337980 2:121073931-121073953 CAAGGCCAAGTCCCTGTAATAGG - Intergenic
945405152 2:209437837-209437859 CAAATACAAGTCCTGATAAGGGG - Intronic
946973368 2:225120396-225120418 CAAACACAAGGCACTCTAATGGG + Intergenic
947622455 2:231599384-231599406 CAAGCCCAGGTCCCCATAATGGG - Intergenic
947775201 2:232703101-232703123 TAATACCAAGTCCCTATAATGGG + Intronic
1168956445 20:1837623-1837645 CAAACCCAAGTCCCTTTCTTTGG - Intergenic
1177913517 21:27058907-27058929 CAATCACAAGGTCCTACAATAGG - Intergenic
1184203354 22:42984611-42984633 CAAAAACTACTCCCTTTAATCGG + Intronic
953237682 3:41120448-41120470 CACACACAAGTCTCTAAAAAGGG - Intergenic
953557915 3:43961524-43961546 CAAACACAAGAGCCCATACTGGG + Intergenic
954941931 3:54381293-54381315 CAAATAAAAATCCCTAAAATGGG - Intronic
959226454 3:103594579-103594601 CAATCACAAGTTTCCATAATAGG + Intergenic
959597924 3:108147912-108147934 CGATCACAAGGCCCTACAATAGG + Intergenic
960021364 3:112957481-112957503 CAAAAAAAATTACCTATAATTGG + Intronic
961231241 3:125312498-125312520 AAATCACAAGTCCCTATCACAGG + Intronic
963331476 3:143920717-143920739 CAATCACAAGGTCCCATAATAGG + Intergenic
963378904 3:144504590-144504612 CAAACACAAGGTCCCACAATAGG + Intergenic
963517960 3:146332652-146332674 CAATCACAAGGTCCTACAATAGG + Intergenic
964977629 3:162639431-162639453 CAATCACAAGGCCCCACAATAGG + Intergenic
965652005 3:170943982-170944004 CTAACACAAGGTCCTAAAATAGG + Intergenic
965996214 3:174885817-174885839 CAATCACAAGTTCCCACAATAGG + Intronic
968469297 4:771526-771548 GAAACACAAGTCCTCAAAATTGG + Intergenic
970963090 4:21896406-21896428 CAAACACAAGTCCTTTTTCTTGG - Intronic
972085549 4:35209818-35209840 CAACCACAAGGTCCCATAATAGG - Intergenic
974380270 4:61130669-61130691 CAATCACAAGTTCCCACAATAGG + Intergenic
977254314 4:94723902-94723924 AAAACACAAGGCCCACTAATGGG + Intergenic
978341231 4:107722872-107722894 CAATCACAAGGTCCTACAATAGG + Intergenic
978966958 4:114751670-114751692 CAATCACAAGTCCCCACAATAGG - Intergenic
980750830 4:137085775-137085797 CAATCACAAGGTCCTACAATAGG + Intergenic
985019139 4:185669202-185669224 CAAACTCAAGTGCCCATCATGGG + Intronic
986391468 5:7291299-7291321 CAAACACAAGACCTCATAAAAGG - Intergenic
987002217 5:13671425-13671447 CAATCACAAGGTCCTACAATAGG + Intergenic
988850380 5:35174659-35174681 CACACCCAAGTCCCTCTACTTGG + Intronic
989438025 5:41437430-41437452 CAATCACAAGTCACTATCACAGG - Intronic
990009496 5:50979271-50979293 CAAGCATGAGTCCCTATGATAGG + Intergenic
990266496 5:54082121-54082143 CAAATACAAATCCCCCTAATGGG + Intronic
990978999 5:61584859-61584881 CAAACACAAGTCCAGCTAAAGGG - Intergenic
993232302 5:85250892-85250914 CAATCACAAGGTCCTACAATAGG + Intergenic
993319432 5:86455078-86455100 CAATCACAAGTTCCTACAATAGG - Intergenic
995095670 5:108232732-108232754 CAAACACAAGGTCCCACAATAGG - Intronic
995206196 5:109484135-109484157 CAAACTCAAGTGGCTAAAATTGG + Intergenic
995319622 5:110818720-110818742 CAAACATAAGTCCCTAGAAGAGG - Intergenic
995580446 5:113595028-113595050 GAAACACAAGTTGCTCTAATAGG - Exonic
998289990 5:140905862-140905884 CAATCACAAGGCCCAACAATAGG + Intronic
1000117895 5:158170563-158170585 CATACACAAGGCGGTATAATGGG + Intergenic
1000798822 5:165698470-165698492 CAAACAGATTTCCCAATAATAGG + Intergenic
1003708609 6:8563555-8563577 CAAAAACAAAACCCTAAAATTGG - Intergenic
1004198726 6:13528928-13528950 CAGACACAACTCCCTATCAGAGG - Intergenic
1005708139 6:28477438-28477460 CCATCACAAGTGCCTTTAATAGG - Intergenic
1005739667 6:28778693-28778715 CCAACACAATTCCCTTGAATAGG + Intergenic
1009754997 6:67926345-67926367 CACCCACTAGTGCCTATAATAGG - Intergenic
1010520837 6:76834498-76834520 CAAAAAAAAATCCCTATACTTGG - Intergenic
1011069442 6:83364343-83364365 CAATCACAAGGTCCTACAATAGG - Intronic
1012820387 6:104079547-104079569 CAATCACAAGGTCCTACAATAGG - Intergenic
1016091785 6:139988258-139988280 CAATCACAAGTTCCTATATCAGG + Intergenic
1019434203 7:1013411-1013433 GAAACTCAAGTCCCTAGAAGGGG - Intronic
1020469945 7:8524532-8524554 TAAACAAAAGTCCCCTTAATTGG - Intronic
1021052301 7:16002687-16002709 CAAAACCAAGTCCATATTATAGG - Intergenic
1025840607 7:65142200-65142222 CAAACACAAGGCCCCACAACAGG - Intergenic
1025878108 7:65507964-65507986 CAAACACAAGGCCCCACAAAAGG + Intergenic
1025882445 7:65553759-65553781 CAAACACAAGGCCCCACAAAAGG + Intergenic
1025890998 7:65648844-65648866 CAAACACAAGGCCCCACAAAAGG - Intergenic
1028498770 7:91493592-91493614 AAAACACGAGTCGCTAAAATTGG - Intergenic
1030518402 7:110565769-110565791 CAAACACAAATACCTAGCATAGG - Intergenic
1030989833 7:116287103-116287125 CAATCACAAGGCCCCACAATAGG + Intergenic
1031474116 7:122202661-122202683 CAATCACAAGGTCCCATAATAGG + Intergenic
1031474843 7:122208747-122208769 CAATCACAAGGTCCTATGATAGG + Intergenic
1031661250 7:124427730-124427752 CAATCAGAAGTCACAATAATTGG + Intergenic
1032152752 7:129444292-129444314 CAATCACAAGGTCCCATAATAGG + Intronic
1033683932 7:143621882-143621904 CAAACATCAGTCCCTTTAGTTGG - Intronic
1033687108 7:143701071-143701093 CAAACATCAGTCCCTTTAGTTGG - Intronic
1033700680 7:143835756-143835778 CAAACATCAGTCCCTTTAGTTGG + Intergenic
1042377044 8:68063558-68063580 ACAACACAAGTCACTATATTAGG + Intronic
1050627740 9:7523378-7523400 CACACACACGTCCCTATCAAAGG - Intergenic
1050931251 9:11330033-11330055 CAAACAAAAGGCTCTATAGTAGG - Intergenic
1053262967 9:36686744-36686766 CAATCACAAGGTCCTACAATAGG + Intergenic
1053409774 9:37908335-37908357 AAACCACAGGTCACTATAATGGG - Intronic
1054815640 9:69472562-69472584 TAAAGACAAGTCCCTAAAATGGG + Intronic
1055676885 9:78672280-78672302 CGATCACAAGCCCCTACAATAGG + Intergenic
1055731093 9:79279855-79279877 CAAACACCAGTCCCATTAAATGG + Intergenic
1056313901 9:85370244-85370266 CAATCACAAGATCCTACAATAGG + Intergenic
1059066496 9:111091061-111091083 CAATCACAAGTTCCCAAAATAGG - Intergenic
1059935699 9:119308348-119308370 CAAACACAAGCCCCTGGAGTGGG + Intronic
1061734585 9:132645272-132645294 CATAGCCAAGTCCCTAAAATAGG + Intronic
1186244578 X:7607124-7607146 CAATCACAAGGTCCCATAATAGG - Intergenic
1190412413 X:50150183-50150205 CAATCACAAGTTCCCACAATAGG - Intergenic
1193106351 X:77678466-77678488 CAAACACAACAAACTATAATGGG - Intronic
1193297381 X:79849086-79849108 CAATCACAAGGTCCTAAAATAGG - Intergenic