ID: 1070054576

View in Genome Browser
Species Human (GRCh38)
Location 10:72923086-72923108
Sequence AGTCAGGGGTTAGAGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070054576_1070054583 15 Left 1070054576 10:72923086-72923108 CCACTGGTCTCTAACCCCTGACT No data
Right 1070054583 10:72923124-72923146 GACTTGGACCCCCAAAGTGCTGG No data
1070054576_1070054584 16 Left 1070054576 10:72923086-72923108 CCACTGGTCTCTAACCCCTGACT No data
Right 1070054584 10:72923125-72923147 ACTTGGACCCCCAAAGTGCTGGG No data
1070054576_1070054581 -1 Left 1070054576 10:72923086-72923108 CCACTGGTCTCTAACCCCTGACT No data
Right 1070054581 10:72923108-72923130 TTCAGGTGATCCATGTGACTTGG No data
1070054576_1070054587 24 Left 1070054576 10:72923086-72923108 CCACTGGTCTCTAACCCCTGACT No data
Right 1070054587 10:72923133-72923155 CCCCAAAGTGCTGGGATTACAGG 0: 2883
1: 292782
2: 266076
3: 153028
4: 133197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070054576 Original CRISPR AGTCAGGGGTTAGAGACCAG TGG (reversed) Intronic
No off target data available for this crispr