ID: 1070056980

View in Genome Browser
Species Human (GRCh38)
Location 10:72944989-72945011
Sequence CTTCATTTCCTAGCCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070056980_1070056984 7 Left 1070056980 10:72944989-72945011 CCAAGGTGGGCTAGGAAATGAAG No data
Right 1070056984 10:72945019-72945041 CCATGAGCCCAGCTAAAACGTGG No data
1070056980_1070056985 11 Left 1070056980 10:72944989-72945011 CCAAGGTGGGCTAGGAAATGAAG No data
Right 1070056985 10:72945023-72945045 GAGCCCAGCTAAAACGTGGAAGG No data
1070056980_1070056987 14 Left 1070056980 10:72944989-72945011 CCAAGGTGGGCTAGGAAATGAAG No data
Right 1070056987 10:72945026-72945048 CCCAGCTAAAACGTGGAAGGAGG No data
1070056980_1070056990 16 Left 1070056980 10:72944989-72945011 CCAAGGTGGGCTAGGAAATGAAG No data
Right 1070056990 10:72945028-72945050 CAGCTAAAACGTGGAAGGAGGGG No data
1070056980_1070056989 15 Left 1070056980 10:72944989-72945011 CCAAGGTGGGCTAGGAAATGAAG No data
Right 1070056989 10:72945027-72945049 CCAGCTAAAACGTGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070056980 Original CRISPR CTTCATTTCCTAGCCCACCT TGG (reversed) Intronic
No off target data available for this crispr