ID: 1070056989

View in Genome Browser
Species Human (GRCh38)
Location 10:72945027-72945049
Sequence CCAGCTAAAACGTGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070056980_1070056989 15 Left 1070056980 10:72944989-72945011 CCAAGGTGGGCTAGGAAATGAAG No data
Right 1070056989 10:72945027-72945049 CCAGCTAAAACGTGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070056989 Original CRISPR CCAGCTAAAACGTGGAAGGA GGG Intronic
No off target data available for this crispr