ID: 1070058003

View in Genome Browser
Species Human (GRCh38)
Location 10:72953909-72953931
Sequence CCTGACTGGCATCAATTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070058003_1070058009 -6 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058009 10:72953926-72953948 GTCAGGGACTGAGAGCTGGGAGG No data
1070058003_1070058011 14 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058011 10:72953946-72953968 AGGACGGTGTGAACTGCAGCAGG No data
1070058003_1070058010 -2 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058010 10:72953930-72953952 GGGACTGAGAGCTGGGAGGACGG No data
1070058003_1070058013 16 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058013 10:72953948-72953970 GACGGTGTGAACTGCAGCAGGGG No data
1070058003_1070058012 15 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058012 10:72953947-72953969 GGACGGTGTGAACTGCAGCAGGG No data
1070058003_1070058016 22 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058016 10:72953954-72953976 GTGAACTGCAGCAGGGGGAAGGG No data
1070058003_1070058008 -9 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058008 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG No data
1070058003_1070058014 17 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058014 10:72953949-72953971 ACGGTGTGAACTGCAGCAGGGGG No data
1070058003_1070058015 21 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG No data
1070058003_1070058006 -10 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058006 10:72953922-72953944 GCCAGTCAGGGACTGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070058003 Original CRISPR CCTGACTGGCATCAATTTGC TGG (reversed) Intronic
902677355 1:18018086-18018108 CCTCACTGGCATGAAATTTCTGG + Intergenic
905959687 1:42033229-42033251 ACTGTCTGGCATCACTTTGCAGG - Intronic
910306333 1:85768468-85768490 CCTCACTGGCATCCTTGTGCAGG - Intronic
912339856 1:108902480-108902502 CCTGGCTGGCAACAATTAGTTGG - Intronic
915184575 1:154093939-154093961 CCAGACTGGTCTCAAGTTGCTGG - Intronic
917834855 1:178933463-178933485 CCTGAATTGCATAAATGTGCTGG + Intergenic
1066387370 10:34952616-34952638 CCAGACTGGCCTCAAATTCCTGG + Intergenic
1067938247 10:50629689-50629711 CCTGACTGGCATCAGACTCCTGG + Intergenic
1067939547 10:50642692-50642714 CCAGACTGGCCTCAAATTCCTGG - Intergenic
1070058003 10:72953909-72953931 CCTGACTGGCATCAATTTGCTGG - Intronic
1073060963 10:100733367-100733389 TTTGACTGACATCACTTTGCAGG + Intergenic
1074621198 10:115124727-115124749 CCTCATTGGCATAAATTTTCAGG + Intronic
1076331181 10:129669238-129669260 CCAGACTGGCTTCAAATTCCTGG + Intronic
1086540751 11:87908621-87908643 CCTGTCACACATCAATTTGCAGG + Intergenic
1087433134 11:98079089-98079111 CCAGACTGGTCTCAAATTGCTGG - Intergenic
1087626898 11:100605527-100605549 CCTGACGGGCTTCACTTTGTAGG - Intergenic
1089997914 11:122926539-122926561 CCTCACTGGCATCAACTTTCAGG - Intronic
1094104800 12:26800017-26800039 CCTGGTTGACACCAATTTGCAGG + Intronic
1098722991 12:73925895-73925917 TCTGATTGGCTTCCATTTGCGGG - Intergenic
1099706787 12:86164294-86164316 CCTAATTCACATCAATTTGCTGG - Intronic
1100433241 12:94548936-94548958 CCTGAGTAGCATCAATTTTCAGG - Intergenic
1100516724 12:95335299-95335321 CCAGACTGGCATCAAACTCCTGG - Intergenic
1102794396 12:115675970-115675992 CCTGTCTGGCAATAATTTTCAGG + Intergenic
1102979346 12:117229140-117229162 CCTGACTGGCCTGCAGTTGCAGG + Intronic
1108612773 13:52100469-52100491 CCAGACTGGCATCAAACTCCTGG + Intronic
1109514083 13:63418282-63418304 CCGGACTGGCATTAGTCTGCGGG + Intergenic
1112203088 13:97297278-97297300 CCTGACTATCAGCAATTTGAAGG - Intronic
1117010030 14:51461693-51461715 TCTGCCTGCCACCAATTTGCTGG + Intergenic
1117134982 14:52726507-52726529 CTTGACAGGAAGCAATTTGCTGG - Intronic
1117593446 14:57300952-57300974 CCAGACTGGTCTCAATTTCCTGG + Intergenic
1118070217 14:62238501-62238523 AATGAATGACATCAATTTGCTGG + Intergenic
1118445979 14:65851560-65851582 GCTGACTGGGATCAATGCGCAGG + Intergenic
1126817857 15:52471543-52471565 CCAGGCTGGCCTCAAGTTGCTGG - Intronic
1129593567 15:76940253-76940275 CCAGACTGGCCTCAAATTCCTGG - Intronic
1130547372 15:84867160-84867182 CCAGGCTGGCATCAACTTCCTGG - Intronic
1132934343 16:2473342-2473364 CCAGACTGGCATGACTTTGGGGG + Intronic
1134443048 16:14310765-14310787 CCTGACAGGCCTCACTGTGCCGG + Intergenic
1136852940 16:33627700-33627722 CATGAATGGCATCAACTCGCTGG - Intergenic
1140890915 16:79284413-79284435 CCTGAGTGGCAACTATATGCTGG + Intergenic
1143905018 17:10201184-10201206 CCAGACTGGTCTCAATCTGCTGG - Intergenic
1144276886 17:13678759-13678781 ACTGAATGGCATCATTTTTCTGG + Intergenic
1145770046 17:27486451-27486473 CTTGCTTGGCATCAGTTTGCTGG + Intronic
1148023785 17:44571076-44571098 CCAGACTGGCCTCAAATTCCTGG - Intergenic
1150612731 17:66747278-66747300 CCAGACTGGACTCAATTTCCTGG + Intronic
1153104422 18:1510879-1510901 CCAGACTGCCACCACTTTGCTGG - Intergenic
1158029484 18:52945947-52945969 CCTGACTAGTAACAATTGGCCGG + Intronic
1161373539 19:3927274-3927296 CCTGGCTGGCATCTATCTGCTGG - Exonic
1163629378 19:18409727-18409749 CCAGGCTGGCCTCAAATTGCTGG + Intergenic
1164868470 19:31624574-31624596 CAAGACTGGCATCAGTTTGAAGG - Intergenic
928683601 2:33727091-33727113 CCTGACGGCCGTCAACTTGCTGG - Intergenic
930927180 2:56832233-56832255 CCTGACTGTCCTCCATTTTCTGG + Intergenic
939424950 2:142023370-142023392 GCTGTCTGGCATGAATTTGGAGG + Intronic
940560986 2:155296476-155296498 CCAGACTGGCCTCAAATTCCCGG - Intergenic
942878115 2:180827001-180827023 TCTGACTTGGAGCAATTTGCTGG + Intergenic
947874264 2:233458133-233458155 CCTGACGGGCTTCATGTTGCAGG - Intronic
1169338189 20:4774650-4774672 CCTGACTGGCTTTAATCTTCTGG + Intergenic
1170272398 20:14542117-14542139 CCTGCATGGCATCAGTTAGCTGG + Intronic
1170832787 20:19857774-19857796 CCAGACTGGCTTCAAATTCCTGG - Intergenic
1173140031 20:40473848-40473870 CATGTCTGGCTTCAATTTGTGGG - Intergenic
1173798538 20:45879758-45879780 CTTGACTGCCAGCAACTTGCTGG + Intergenic
1176182905 20:63760018-63760040 TCTCACTGGATTCAATTTGCTGG + Intronic
1182268164 22:29135544-29135566 CCTGAGTGGCATGAGTGTGCAGG - Intronic
1184273129 22:43396004-43396026 CCTCACTGTCATCACTGTGCTGG - Intergenic
1184401010 22:44274412-44274434 CCTGCCTGGCATCTATCTGGAGG + Intronic
1184517064 22:44969177-44969199 CCCTGCTGGCATCAGTTTGCAGG + Intronic
1185184789 22:49392487-49392509 CCTGGCCAGCACCAATTTGCTGG + Intergenic
949642699 3:6057141-6057163 CATGTCTTGCAACAATTTGCAGG + Intergenic
952081493 3:29763348-29763370 CAGGGCTGGCATCAATTTGTGGG - Intronic
952326370 3:32323928-32323950 CCTGGCCTGCATCATTTTGCAGG - Intronic
952947557 3:38489469-38489491 GCAGACTGGAGTCAATTTGCGGG + Exonic
954018446 3:47716898-47716920 CCAGACTGGCCTCAAATTCCTGG - Intronic
956184967 3:66553621-66553643 CCTGAATGGCAGTAATTGGCTGG - Intergenic
956276618 3:67508846-67508868 CCTGAGTAGCATCAATTTTCAGG + Exonic
956800179 3:72750451-72750473 CCTGACTGGCATCAGACTCCTGG + Exonic
964754320 3:160080298-160080320 CCTACCTGGCTTTAATTTGCTGG + Intergenic
964756362 3:160093536-160093558 CCTACCTGGCTTTAATTTGCTGG + Intergenic
967451523 3:189629166-189629188 CCTGACTGGTCTCAAACTGCTGG - Intergenic
968707059 4:2084200-2084222 CTTGACTGGAATCATTTTGAAGG + Intronic
970262129 4:14237137-14237159 CCTGATTGTCATCAATTGGAAGG + Intergenic
971214815 4:24653042-24653064 CCTGACTGTCATCTATTTTCTGG - Intergenic
971368173 4:25994127-25994149 CCTGACTGGGATGATTTTGAAGG + Intergenic
971716812 4:30188577-30188599 TCTGACTTTCATGAATTTGCAGG - Intergenic
973070289 4:45850004-45850026 CCAGACTGGTATCAACTTCCTGG + Intergenic
973917772 4:55653863-55653885 CCTGACTTGAATTCATTTGCTGG + Intergenic
974660597 4:64883351-64883373 CCTGACTGTCACCATTTTGGAGG + Intergenic
980951686 4:139385205-139385227 CCAGACTGGCCTCAAATTCCTGG - Intronic
982475862 4:155849779-155849801 GTTGACTGGCTTCAGTTTGCCGG - Intronic
982479598 4:155893006-155893028 CCTGACTGGCTTCCCTTTGTGGG - Intronic
983185768 4:164698915-164698937 GGTGACTGGCATCTAATTGCTGG - Intergenic
983680037 4:170342680-170342702 CCTATCTGTCATCAATTTGAGGG - Intergenic
984765257 4:183395617-183395639 CCTGAATGGCAAAAATTGGCAGG - Intergenic
986157039 5:5186520-5186542 GCTTACTGGCATCTATTTACTGG + Intronic
991982854 5:72251357-72251379 CCTGACTGGCAAAACTTTGCTGG - Intronic
994967435 5:106692770-106692792 CCAGACTGGCATCAAACTGCTGG + Intergenic
995449781 5:112287875-112287897 GCTGATTGGCTTCATTTTGCTGG + Intronic
997764514 5:136486697-136486719 CCTGACTGGCAGCAAGCTGTGGG + Intergenic
998496688 5:142596393-142596415 CCAGACTGGCCTCAAATTCCTGG - Intronic
998496707 5:142596531-142596553 CCAGACTGGCCTCAAATTCCTGG - Intronic
1002780732 6:363631-363653 CCTGACTGGCATCACTTGGGTGG + Intergenic
1003768801 6:9273756-9273778 CCACACTGGTATCAATTTCCTGG - Intergenic
1004143895 6:13047055-13047077 CCTGTGTGGCGTCATTTTGCAGG + Intronic
1008607522 6:53154681-53154703 TCTCACTGGAATCAATGTGCAGG + Intergenic
1009649290 6:66452493-66452515 CCTGACTGGCATATGTTTGTGGG - Intergenic
1009756277 6:67944075-67944097 CCTTATTTGCTTCAATTTGCAGG + Intergenic
1013568387 6:111393739-111393761 CCAGACTGGAATCAATCTCCTGG + Intronic
1015048953 6:128815747-128815769 CTTAACAGGCTTCAATTTGCAGG - Intergenic
1017722830 6:157256013-157256035 TATGACTGACATCAAATTGCTGG - Intergenic
1020186209 7:5961276-5961298 CCAGACTGGCCTCAAATTCCCGG - Intronic
1020296705 7:6763494-6763516 CCAGACTGGCCTCAAATTCCCGG + Intronic
1021066509 7:16182170-16182192 GCTGCCTGGCATCAATTAGTTGG - Intronic
1021245790 7:18259572-18259594 CCAGACTGGTTTCAAATTGCTGG + Intronic
1021455588 7:20826552-20826574 CCTGACTGGCATCACCTCCCAGG - Intergenic
1023907335 7:44531900-44531922 CCTGACTGACTTAAATTTGTGGG - Intronic
1024228675 7:47347546-47347568 CCTGAATGGCATCTAGTAGCTGG - Intronic
1028071127 7:86452106-86452128 CCTCACTGGCTTCATTTAGCAGG + Intergenic
1028716730 7:93979620-93979642 TCTTACTGGCTTCAATGTGCCGG - Intronic
1031238353 7:119206608-119206630 CCTGACTTGCATGAACTGGCAGG - Intergenic
1032071568 7:128810941-128810963 CTTGAGAGGCATCAATTTTCTGG - Intronic
1040654921 8:49496476-49496498 CCTATCTGGCATCAAGTTGGTGG + Intergenic
1044016348 8:87052068-87052090 CCACACTGGTAACAATTTGCAGG + Intronic
1047233707 8:123019937-123019959 CCTGACGGGAATCATGTTGCAGG - Intronic
1049521275 8:143092652-143092674 CATGACAGGCTTCAGTTTGCAGG - Intergenic
1057021279 9:91699409-91699431 ACTGACTGGCTTCAAGTTGAGGG - Intronic
1059138952 9:111834068-111834090 CCTGATTAGCTTCAACTTGCTGG + Intergenic
1188441109 X:30215885-30215907 CCTAACTGAAATCAATTTGAGGG + Intronic
1190194750 X:48307345-48307367 CCAGGCTGGCCTCAATCTGCTGG + Intergenic
1190955944 X:55193491-55193513 GTTGTCTGGCTTCAATTTGCAGG + Intronic
1193133664 X:77946088-77946110 CCAGGCTGGCATCAAATTCCTGG - Intronic
1197252005 X:124226469-124226491 CCTGACAAGCATCAATTTAAGGG - Intronic
1199231428 X:145440638-145440660 CCTCACTGGCAGCAGTTTGTTGG - Intergenic
1200141790 X:153906193-153906215 CCAGACTGGCATGAATCTCCCGG - Exonic