ID: 1070058007

View in Genome Browser
Species Human (GRCh38)
Location 10:72953923-72953945
Sequence CCCAGCTCTCAGTCCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 321}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070058007_1070058012 1 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058012 10:72953947-72953969 GGACGGTGTGAACTGCAGCAGGG No data
1070058007_1070058015 7 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG No data
1070058007_1070058016 8 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058016 10:72953954-72953976 GTGAACTGCAGCAGGGGGAAGGG No data
1070058007_1070058013 2 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058013 10:72953948-72953970 GACGGTGTGAACTGCAGCAGGGG No data
1070058007_1070058014 3 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058014 10:72953949-72953971 ACGGTGTGAACTGCAGCAGGGGG No data
1070058007_1070058011 0 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058011 10:72953946-72953968 AGGACGGTGTGAACTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070058007 Original CRISPR CCCAGCTCTCAGTCCCTGAC TGG (reversed) Intronic
900166968 1:1247701-1247723 CCGGGCTCTCAGGCACTGACTGG + Intergenic
900512228 1:3066225-3066247 CCCAGTTCTGTGTCCCTGCCTGG - Intergenic
900536289 1:3179353-3179375 TCCAGCCCTCAGCCCCTCACTGG + Intronic
900601760 1:3505739-3505761 CCAAGCTCTGAGTCCCTGGTGGG - Intronic
901665609 1:10824531-10824553 CCCAGCACCCAGTCCTTGGCAGG + Intergenic
902437392 1:16407318-16407340 CACAGCTCCCAATCCCTGTCTGG - Intronic
904489715 1:30850899-30850921 TCCAGCTCTCAGCCCCTCCCAGG - Intergenic
904661880 1:32091604-32091626 CCCAACTCTCAGCCACTGAGGGG - Intronic
909094455 1:71270493-71270515 CACAGCTCTCAGCCCCTCACAGG + Intergenic
910149545 1:84125958-84125980 CGCAGCTCTCATCCCCTCACGGG + Intronic
910463322 1:87470984-87471006 CCCAGCTCTCTGTGCCTAAGTGG + Intergenic
912491266 1:110064036-110064058 GCCAGCGCTCAGACCCTGGCTGG - Intronic
913602430 1:120434504-120434526 CCCAGCCCTCACCCCATGACAGG + Intergenic
914084618 1:144442004-144442026 CCCAGCCCTCACCCCATGACAGG - Intronic
914190629 1:145407271-145407293 CCCAGCCCTCACCCCATGACAGG - Intergenic
914363601 1:146958134-146958156 CCCAGCCCTCACCCCATGACAGG + Intronic
914488074 1:148128992-148129014 CCCAGCCCTCACCCCATGACAGG - Intronic
914588436 1:149084145-149084167 CCCAGCCCTCACCCCATGACAGG - Intronic
915100987 1:153499961-153499983 CCCAGCTCCAACTCCCAGACAGG + Intergenic
915506347 1:156358892-156358914 CCCATCTCTTTGTCTCTGACTGG + Intronic
917125486 1:171683861-171683883 GCCAGCTCTCATTCGCTGAGAGG + Intergenic
918096024 1:181334896-181334918 GCCAGCTCTCAGACCCTGCAGGG - Intergenic
918125333 1:181578819-181578841 CCCAGTTCTCAGTCTCTGTTGGG - Intronic
918378536 1:183932786-183932808 CCGATCTCTCAGGCCCTGAGAGG - Intronic
918428957 1:184438573-184438595 CCCAGACCTCAGTCCATGTCTGG - Intronic
918448059 1:184634009-184634031 CCAAGCTGTCAGTCCCTGATAGG - Intergenic
919728844 1:200900405-200900427 CCCAGCTCTCGGTTCCTTAGTGG - Intronic
920044641 1:203125507-203125529 CCCTGCTCTCTGTGCCTCACAGG + Intronic
920077036 1:203344719-203344741 CCCATCCCCAAGTCCCTGACTGG + Intronic
920193546 1:204211291-204211313 CACAGCTCACAGGCCCTGCCTGG + Intronic
922574073 1:226650844-226650866 ACCAGCTGTCTGTCCCTCACCGG - Intronic
923023641 1:230187382-230187404 CACAGCTCTCAGCCCCTCATGGG + Intronic
924282935 1:242456204-242456226 CCCAGCTCAGAGTCACTGAATGG - Intronic
1062970637 10:1645667-1645689 CCCAGCTCTGAGTCCATCCCTGG + Intronic
1065656239 10:27953928-27953950 CCCAGCTCTTGCTCCCTGAGTGG - Intronic
1066431564 10:35356851-35356873 CCCTGCTCACAATCCCTGAGTGG + Intronic
1066677719 10:37905778-37905800 CCCAGCCCCCAACCCCTGACAGG - Intergenic
1067060118 10:43073956-43073978 CCCAGATCTCTGTCCATGATGGG + Intergenic
1067569260 10:47359764-47359786 GCCAGCTTTGAGTCCCTGCCAGG - Intergenic
1067800296 10:49353898-49353920 CTCAGCTCTGAGTCCCAGAGAGG - Intergenic
1068178428 10:53491874-53491896 CCTAGCTCTCAGTCTCTGTGTGG + Intergenic
1069576009 10:69528967-69528989 CCCAGCTTTCAGACCCTCCCTGG + Intergenic
1070058007 10:72953923-72953945 CCCAGCTCTCAGTCCCTGACTGG - Intronic
1070287115 10:75092162-75092184 GCCAGCTTTCAGTCCAAGACTGG + Intergenic
1070566935 10:77610710-77610732 CTCTGCTCCCAGTCCCTGGCTGG - Intronic
1071261882 10:83927487-83927509 CCCAGCTCTCAGTCTCTCACAGG + Intergenic
1071514904 10:86290977-86290999 TCCAGGTCCCAGTCCCTGAAAGG + Intronic
1072269105 10:93757928-93757950 CCCATCTCACAGTACCTCACAGG + Exonic
1073845709 10:107551455-107551477 CCCAGCCCCCATCCCCTGACGGG - Intergenic
1074116359 10:110460044-110460066 CCCAGCACTCAGCGCCTGAAAGG + Intergenic
1074424450 10:113338678-113338700 CCCCACACTCAGTCACTGACTGG - Intergenic
1074871467 10:117579327-117579349 CCAAGCTCTCAGTCACTCAGTGG + Intergenic
1076383424 10:130040198-130040220 CCCAGCCCCCAGTCCCTGCTGGG + Intergenic
1077177681 11:1198025-1198047 CCCAGCCCACGGCCCCTGACAGG - Intronic
1077211899 11:1375057-1375079 CCCACCTCTGAGTCCCTGGAAGG + Intergenic
1077213218 11:1383019-1383041 CCCAGCTCTCAGGCGGTGAAGGG + Intergenic
1077433770 11:2528496-2528518 CCCTGCTCTCAGCACCTGCCTGG - Intronic
1079469489 11:20764833-20764855 CCCAGTTCTCATTCCTTGATTGG - Intronic
1081602050 11:44502022-44502044 CCCAGCTCACAGCCTCTGAGGGG + Intergenic
1081605442 11:44524635-44524657 GCCTGCTCTCTGTCCCTGCCTGG + Intergenic
1083312387 11:61790899-61790921 CCCCGCTATAAGTCACTGACTGG + Intronic
1083319992 11:61839767-61839789 CCCACCTCTCAGCCCCTGGCAGG + Intronic
1083669672 11:64292740-64292762 CCCGGCCCTCAGCCCCTGTCTGG - Exonic
1084118883 11:67057324-67057346 CCAAGCTCTCAGGCCCTCAGCGG - Intronic
1084156276 11:67314506-67314528 CACAGCTCTGAGTTCCTGATTGG - Intergenic
1084462096 11:69301899-69301921 CCCAGCCCTCTCTCCCTGCCAGG - Intronic
1084494829 11:69497748-69497770 CCCAGGTCTCAGGCACTGAGGGG - Intergenic
1084594005 11:70106435-70106457 CCCAGCCCTCTGTCTCTGCCCGG - Intronic
1085035559 11:73297734-73297756 CCCAGCTCTCCATGGCTGACTGG - Exonic
1085711311 11:78831344-78831366 CCCAGCTCCCAGCTCCTGGCCGG + Intronic
1086068081 11:82767933-82767955 CCAAGCCCTGAGTCCCTGAAGGG + Intergenic
1086145124 11:83543247-83543269 CCCAGCTCCCTGTTCCTGACTGG - Intronic
1088513270 11:110599573-110599595 CCCAGCTTTCAGGCCCTCCCTGG - Intronic
1089505789 11:118961286-118961308 CCCAGCTTTCAGGCCCTCCCTGG + Intergenic
1090256478 11:125287975-125287997 CCCAGCTCCAAGTACCTGCCAGG + Intronic
1091322688 11:134663217-134663239 CCCACCTCTCAGGCCCTGCAGGG - Intergenic
1093370255 12:18356332-18356354 CATAGCTCTCAGCCCCTCACAGG + Intronic
1095565018 12:43612814-43612836 CCCAGCCCCCACACCCTGACAGG - Intergenic
1095694905 12:45133036-45133058 CCCTTCCCCCAGTCCCTGACTGG - Intergenic
1096231060 12:49897226-49897248 CCCAGCCCACAGTCCCCGGCTGG + Intronic
1097182393 12:57178885-57178907 CCCAGCTCCCAATCCCTGTGAGG + Exonic
1097368643 12:58748157-58748179 CCCAGCCCCCACCCCCTGACAGG + Intronic
1098472438 12:70861201-70861223 CCCACCTCTCATTCCCTGCTAGG - Intronic
1100790088 12:98120672-98120694 GTCAGCTCTCAGTCCCTCATGGG - Intergenic
1101701052 12:107174339-107174361 CCCAGCTCTCACTATGTGACAGG + Intergenic
1101764002 12:107682233-107682255 CCCAGCTTTCAGGCCCTCCCTGG + Intergenic
1102464690 12:113121624-113121646 TCCAGCTGTCAATCCCTGAAGGG + Exonic
1102936010 12:116897649-116897671 CTCAGCTCTCAGTCCCCTATGGG + Intergenic
1103792124 12:123479236-123479258 CCCAGCTCTGGGTCCCTGACAGG + Intronic
1104289849 12:127456645-127456667 CCCCACTCTGAGACCCTGACAGG - Intergenic
1104896616 12:132168022-132168044 CCCAGGTTTCAATCCCTGCCAGG - Intergenic
1105611746 13:21974840-21974862 TCCAGCCCCCAGTCCCTGGCTGG - Intergenic
1107070158 13:36259889-36259911 CCCTGCGCCCAGTCCCTGGCAGG - Intronic
1108087350 13:46807716-46807738 CCTAGCCCCCAGCCCCTGACAGG + Intergenic
1108500300 13:51064152-51064174 CCCAGCCATCATTCCCTGTCAGG + Intergenic
1109462095 13:62674175-62674197 CCCTGCCCACACTCCCTGACAGG - Intergenic
1112493175 13:99885061-99885083 CCCAGCACCCAGTACCTGCCAGG - Intronic
1112956124 13:105060026-105060048 TGCAGCTCTCAGCCCCTCACAGG - Intergenic
1113741876 13:112716712-112716734 CCCAGGTCTCAGCCAGTGACGGG + Intronic
1113897567 13:113775815-113775837 CCCAGCTCTCCGTGCCTGTCAGG + Intronic
1117044889 14:51803385-51803407 CCCAGCCCCCAACCCCTGACAGG - Intergenic
1117060448 14:51957039-51957061 CCCGGTTCTCAGTCCCGGTCTGG + Intronic
1117866834 14:60158775-60158797 CCCATCTCTAATTCCCTCACAGG + Intronic
1119329972 14:73786735-73786757 CGCAGCTCTCGGCCCCTGCCCGG - Intronic
1119533359 14:75379427-75379449 CCCTGCACTGAGTCCCTGCCTGG - Intergenic
1122425867 14:101604925-101604947 CCCAGCTCTCTGGCCCAGGCAGG + Intergenic
1122615561 14:103015575-103015597 CCCTGCTCTCAGTACCTGTGTGG - Intronic
1122707614 14:103630874-103630896 CACAGCACTCAGTGCCAGACAGG - Intronic
1122855576 14:104558519-104558541 CCCAGCTGTGGGTCACTGACTGG - Intronic
1123020993 14:105397880-105397902 CCCAGCTCTCAGTCCCCTACAGG - Exonic
1123858074 15:24434739-24434761 CCCAGCTCTTAGTCCCTCTTAGG + Intergenic
1123862702 15:24485197-24485219 CCCAGCTCTTAGTCCCTCTTAGG + Intergenic
1127017763 15:54708189-54708211 CCCAGCCTTCAGTCCCTGCGTGG + Intergenic
1127406251 15:58650390-58650412 ACCACATCTCAGTCCCTAACTGG - Intronic
1128249052 15:66152117-66152139 TCCAGCTCTCAGCCCCTCATGGG + Intronic
1128293991 15:66501475-66501497 GCCAGCTCTCATTCGCTGAGAGG + Exonic
1128336072 15:66786556-66786578 GCCAGGTCTGAGTGCCTGACAGG - Intergenic
1128867120 15:71122482-71122504 CCCTGCTCTCAGCCTCTTACAGG + Intronic
1130331224 15:82923763-82923785 TCCAGCTGTCAGGCCCTGCCAGG - Intronic
1130921091 15:88345111-88345133 CCCAGCTCTGTGTGCCTGAGTGG + Intergenic
1131046934 15:89322415-89322437 CCCAGCTCCCAGCCCCCAACAGG + Intronic
1132697452 16:1208240-1208262 CCCAGCTCTCAGGCCCCTTCAGG + Intronic
1135978345 16:27126313-27126335 CCTTGCTCCCAATCCCTGACAGG - Intergenic
1136297843 16:29313803-29313825 CCCAGCTGTCAGACACTGGCGGG + Intergenic
1136580734 16:31149481-31149503 CCCAGCTCTCAGTCCTACCCAGG - Exonic
1139373401 16:66481822-66481844 CCCCTCCCTCAGTCCCTGCCTGG + Exonic
1139636173 16:68259944-68259966 CCCTGGTCCCAGTCCCTGCCTGG + Exonic
1139657287 16:68396611-68396633 CACAGGGCCCAGTCCCTGACAGG + Intronic
1140419580 16:74807491-74807513 CCCAGCTGTCAGGCCCTCCCTGG + Intergenic
1141645633 16:85366006-85366028 ACCAGCTCTCTGTCGCTGCCAGG - Intergenic
1141834776 16:86531582-86531604 CCCAGCATCCAGTCCCTGCCAGG + Exonic
1142060012 16:88023147-88023169 CCCAGCTCTCAGTCACCGTGAGG - Intronic
1142155319 16:88530280-88530302 ACCACCTCCCAGTCCCTGAGGGG + Intronic
1142196672 16:88742284-88742306 CCCAGCTGTGAGTCGCTGAGGGG - Exonic
1142612403 17:1116483-1116505 CACAGCTCTCACGCCCTGTCTGG - Intronic
1145817336 17:27805039-27805061 CCCAGGTCTGAGACCTTGACTGG + Intronic
1146594543 17:34157336-34157358 CCCAGCTCCCTGTCCCTGCTAGG + Intronic
1147238934 17:39077824-39077846 GCCCCCTCTCTGTCCCTGACAGG - Intronic
1147741564 17:42673476-42673498 CCCAGCGCTCAGCCTCTGCCTGG + Exonic
1147924104 17:43936074-43936096 ACCAGGTCACAGTCCCTGCCGGG - Intergenic
1148146273 17:45366971-45366993 GCCAGTTCTCAGCCCCTGAAGGG + Intergenic
1148206365 17:45782835-45782857 CCCAGCTCACAGTGCCTGGAGGG - Intergenic
1148537823 17:48455501-48455523 CCCAGCTCTCAATCCCTCACAGG - Intergenic
1148732433 17:49845653-49845675 CCCAGCTCCCAGCTCCTGGCAGG - Intronic
1149405755 17:56349220-56349242 CCCAGCCCGCACTCACTGACAGG - Intronic
1150223076 17:63508088-63508110 TCCAGCACTCAGTCCCTTCCAGG + Intronic
1150617712 17:66784946-66784968 CCCTGTTCTGAGTCCCTCACAGG + Intronic
1150855547 17:68748967-68748989 CCCACATCCCACTCCCTGACAGG + Intergenic
1150856486 17:68758205-68758227 CCCACATCCCACTCCCTGACAGG - Intergenic
1151315701 17:73321000-73321022 CCCAGACCCCAGCCCCTGACTGG + Intergenic
1151380017 17:73719424-73719446 CCCGCCTCACAGTTCCTGACCGG + Intergenic
1151675612 17:75595883-75595905 CCCTGCCCTCAGTCCCTGGACGG + Intergenic
1153204476 18:2682354-2682376 CCCACCTCTCAGCCCCAGGCTGG + Intronic
1153965149 18:10173713-10173735 CCCAGCCCCCAACCCCTGACAGG + Intergenic
1156124514 18:33887567-33887589 CCCAGCCCCCACCCCCTGACAGG + Intronic
1157565047 18:48674276-48674298 CCCAGGTCACAGTCCCTGAAGGG + Intronic
1161076043 19:2286280-2286302 GCCGCCTCACAGTCCCTGACAGG + Intronic
1164023476 19:21329419-21329441 CCCAGCTCAGAGTCCCTGATTGG + Intronic
1164177038 19:22784210-22784232 CCCAGCCCAGAGTCCCTGATTGG + Intergenic
1164226498 19:23250453-23250475 CCCAGCTCAGGGTCCCTGATTGG + Intergenic
1164279738 19:23758955-23758977 CCCAGCCCAGCGTCCCTGACTGG + Intergenic
1164533453 19:29065528-29065550 CCCAGCTCGCAGTCACAGGCAGG + Intergenic
1165229372 19:34377388-34377410 CCCAGCTTTCAGGCCCTCGCAGG - Intronic
1165610446 19:37146849-37146871 CCCAGCTCTAACTCCATGTCAGG - Intronic
1166411506 19:42558467-42558489 CCCAGCTCTTAGAGCCTGGCTGG + Intronic
1166939472 19:46354025-46354047 CCCAGCCCTCAGTATCTGCCTGG - Intronic
1167377211 19:49118665-49118687 CCCAGCACTCAGACCCAGACTGG - Exonic
926215056 2:10901211-10901233 CCCAGATCTCAGGCCCAGAGGGG + Intergenic
927423435 2:22956051-22956073 CGCAGATCTCAGGCACTGACTGG - Intergenic
927932299 2:27052908-27052930 CCCAGCTCTCAGGGCCAGAGCGG + Exonic
929401700 2:41590265-41590287 CCTGGCTCTTAGTCCCTGGCTGG - Intergenic
931214067 2:60225381-60225403 CCCAGCGCTCTGACCCTGCCAGG - Intergenic
931793769 2:65689932-65689954 CCCAGCTCTCATTTATTGACTGG + Intergenic
932167922 2:69525183-69525205 ATCAGCTCTCAGTCCCAGTCAGG - Intronic
932679926 2:73816227-73816249 CCCAGCTCTCAAACCATGGCTGG + Exonic
933093284 2:78146701-78146723 CCCAGCCCTCAGGCCCTCCCTGG - Intergenic
935691822 2:105739185-105739207 CCCATCTCTCAGTGACTGGCAGG - Intergenic
936887417 2:117329467-117329489 CACAGATCTTAGTCCTTGACTGG - Intergenic
936970821 2:118174963-118174985 CCAAGCTCTCATCCCCTCACTGG - Intergenic
937019029 2:118633565-118633587 GCCAGCTCCTAGTCCCTGCCCGG + Intergenic
938380094 2:130831717-130831739 CACTGCCCTCATTCCCTGACTGG - Intergenic
941399687 2:165015241-165015263 GCCAGCACGCAGACCCTGACTGG + Intergenic
942195412 2:173513560-173513582 CCCAGCTCTAATTCCGTGAAGGG - Intergenic
943237405 2:185339840-185339862 CCAACCTCTCATCCCCTGACAGG + Intergenic
943891310 2:193290229-193290251 CCCAGCTCTCAGTTCTGGCCAGG + Intergenic
944587527 2:201185749-201185771 CCCACCTCTCTGTCCCTTTCAGG + Exonic
945143566 2:206713481-206713503 GCCATCTCTCATTCCCTGAAAGG + Intronic
947642786 2:231716318-231716340 CCCAGATCTCAGTCCCTCCAGGG + Intergenic
947972487 2:234335886-234335908 CCCACCTCTCAGGGCCTGTCTGG + Intergenic
948416534 2:237810429-237810451 CCCAGCTATCACATCCTGACTGG + Intronic
948702699 2:239770190-239770212 CCCTGCTCTCAGTCCCTCAGAGG - Intronic
948766536 2:240224850-240224872 CCCAGCCCTCAGTCACTGCTTGG + Intergenic
949048324 2:241882433-241882455 CCCTCCTCTCCGTCCCTGGCTGG + Intergenic
1170766292 20:19292203-19292225 GCCAGTGCTCAGTCCCTGAGTGG + Intronic
1172909069 20:38392828-38392850 CCCAAATCTCAGTGACTGACAGG - Intergenic
1173802314 20:45902158-45902180 CCCAGCTCTCAGTGGCTTACAGG + Intronic
1173932508 20:46832624-46832646 CACAGCTCTCTGGCCCTGCCTGG - Intergenic
1175224234 20:57435664-57435686 CTCAGCTCTGAGCCCCTGAGCGG - Intergenic
1175273208 20:57749249-57749271 CCCAGCTCCCAGGGCCTGAGAGG + Intergenic
1175711009 20:61220889-61220911 CCCAGCGCTAAGACCCTGGCAGG + Intergenic
1176284634 21:5012845-5012867 CCCAGGCCGCAGTCCCTGCCCGG - Intergenic
1176295075 21:5067420-5067442 CCCAGCTCTCAGCCTCTTCCTGG + Intergenic
1178086991 21:29122176-29122198 CGCAGCACTCAATCCCTTACGGG + Intronic
1178405676 21:32321295-32321317 ACCAGCTCTTGGTTCCTGACTGG + Intronic
1179861974 21:44194708-44194730 CCCAGCTCTCAGCCTCTTCCTGG - Intergenic
1179872547 21:44250630-44250652 CCCAGGCCGCAGTCCCTGCCCGG + Intronic
1180014351 21:45073032-45073054 GCCAGCCCGCAGTCCCGGACAGG - Intergenic
1180099200 21:45576577-45576599 CCCAGCCCCCGGTCCCTGCCAGG + Intergenic
1180904406 22:19398570-19398592 CTCATCTCCCAGACCCTGACAGG + Intronic
1182115225 22:27752728-27752750 CCCAGCTTTCTGTCCCTTCCAGG - Intronic
1182469576 22:30539880-30539902 CTCAGCTCTCAGACCCTGCAGGG - Intronic
1183083866 22:35474557-35474579 GCCAGCTCTCCCTCCCTGGCTGG + Intergenic
1183420437 22:37708829-37708851 CCCAGCTCTGATTTCCTGTCTGG - Intronic
1183688808 22:39376708-39376730 CACGGCTCTCAGGCCCTGCCTGG - Intronic
1183779511 22:39989822-39989844 CACAGCCCTCAGTGCCTGGCGGG + Intergenic
1183928164 22:41220690-41220712 CCCAGCTCACCCTCCCTCACAGG + Intronic
1184348304 22:43926208-43926230 CACAGCTCTCCTTCCCTGAGTGG - Intronic
1184657023 22:45947019-45947041 CCCAGCTCCCAGCCCATGCCAGG + Intronic
1184677900 22:46053644-46053666 CCCAGCCCCCAGCCCCTGGCCGG - Intronic
950554085 3:13684726-13684748 CCTAGCTCCCAGCCCCTGAGAGG + Intergenic
950739784 3:15041040-15041062 CCCAACCCTGGGTCCCTGACTGG - Intronic
953899320 3:46830424-46830446 CCCAGCTCACAATCCCTACCTGG + Exonic
954593583 3:51805086-51805108 CCCTCTTCTCAGGCCCTGACTGG - Intergenic
957286535 3:78223652-78223674 CCCAACTCTCAGCCACTGGCTGG + Intergenic
957917341 3:86703439-86703461 CCCAGCCCCCATCCCCTGACAGG + Intergenic
958572974 3:95911758-95911780 CCCAGCTTTCAGGCCCTTCCTGG + Intergenic
961829804 3:129617680-129617702 CCCAGCTCACAGCCCCTGGCGGG + Intergenic
963988503 3:151626168-151626190 CCCAACCCTCACCCCCTGACTGG + Intergenic
964907686 3:161737961-161737983 CCCAACCCCCACTCCCTGACAGG + Intergenic
965208469 3:165751968-165751990 CACAGCTCTCAGCCCCTCACAGG - Intergenic
965261349 3:166489664-166489686 CCCAGCTTTCAGGCCCTTCCTGG - Intergenic
965619981 3:170633643-170633665 TCCAGCTCACAGTTCATGACCGG - Intronic
966113179 3:176428521-176428543 CCCAGCTCTCAGTGTCTCAGGGG - Intergenic
966852983 3:184175834-184175856 CCCATCCCTCAGTCCCAAACAGG - Intronic
967009421 3:185418203-185418225 GCCAGCTCTCATTCGCTGAGAGG + Intronic
967295781 3:187963303-187963325 CCCAGCACTCAGTTCCTAATTGG - Intergenic
968040105 3:195581574-195581596 CCCAGCTCTCTGCCCCTTCCAGG - Intronic
968085143 3:195870820-195870842 CCCAACTCTCAGGCCCTTGCTGG + Intronic
968479875 4:828592-828614 CCCAGCTCACACACCCTGAGTGG - Intergenic
968573872 4:1355960-1355982 CCCAGCTCTCAGGCCCCTCCAGG - Intronic
968658686 4:1789805-1789827 CCCAGCTCTGAGTCACCGCCAGG + Intergenic
969573985 4:8025746-8025768 CCCAACTGTGAGTCCCTGAGAGG - Intronic
970469906 4:16367440-16367462 CCCAGCCCCCACCCCCTGACAGG + Intergenic
973122992 4:46546033-46546055 CCCAGCCCTCACCCTCTGACAGG + Intergenic
973826032 4:54708473-54708495 TCCAGCTATCAGTCACTTACTGG + Intronic
974311514 4:60216604-60216626 CCCAGCAGTCAGTACCTGCCTGG - Intergenic
975811931 4:78178709-78178731 CCCTGCTCTCAGCCAGTGACTGG + Intronic
975850075 4:78563275-78563297 CCCTGATCCCAGTCCCTCACAGG + Intronic
976730244 4:88254168-88254190 CTCAGCTCCCAGCCCCTGGCTGG - Intergenic
978403559 4:108356189-108356211 CCCAGCTCACAGTGCCAGATGGG - Intergenic
978980574 4:114940501-114940523 CACAGCTTTCAATCCCTAACAGG + Intronic
979031616 4:115655321-115655343 CCCAGCCCCCACCCCCTGACAGG - Intergenic
980097262 4:128504351-128504373 CACAGCTCTCAATCCCTCATGGG + Intergenic
981843291 4:149137052-149137074 CCCAGCCTTCTGTCCTTGACTGG + Intergenic
982601694 4:157459382-157459404 CCTAGCTCCCAACCCCTGACAGG - Intergenic
984046998 4:174813942-174813964 CACAGCTCTCAAACCCTCACGGG + Intronic
986125363 5:4878990-4879012 CCCAGGACCCAGTCACTGACAGG + Intergenic
986785581 5:11111375-11111397 CCCACCTCTGACTCCCTGGCTGG + Intronic
986838269 5:11666915-11666937 CCCAGCCCCCACCCCCTGACAGG + Intronic
987268396 5:16279752-16279774 CACAGCTCTCAACCCCTCACAGG + Intergenic
987632157 5:20487998-20488020 CCCATCTCTCAGTGGCTGATTGG + Intronic
989539835 5:42605924-42605946 CCCAGCTCTCAGTTTCTCCCTGG - Intronic
992213880 5:74506899-74506921 CCCAACTGTTAGTCACTGACTGG - Intergenic
993184457 5:84600083-84600105 CGCAGCTCTCAATCCCTTGCAGG + Intergenic
994622435 5:102179157-102179179 GTCAGCTATAAGTCCCTGACTGG + Intergenic
996668788 5:126091938-126091960 CCCAGCCCTCACCCGCTGACAGG - Intergenic
996943932 5:129043774-129043796 CCCAGCTTTCAGCTCCTGTCTGG + Intergenic
998253086 5:140565667-140565689 CCCATCTGTCAGTCCCTTCCTGG + Exonic
999229589 5:150053850-150053872 CTCAGCCCCCAGCCCCTGACTGG + Exonic
999300214 5:150486173-150486195 CCCAGCCCCCAGTCCCGGCCCGG - Intronic
999383381 5:151137436-151137458 CCCAGCTCTTAGGCACTGATTGG + Intronic
1001603404 5:172943678-172943700 CCCAGCTCTGTGGCCCTGGCTGG - Intronic
1002096372 5:176833605-176833627 CCCAGCTTCCTCTCCCTGACAGG + Intronic
1004098638 6:12585491-12585513 CGAAGCCCACAGTCCCTGACAGG + Intergenic
1004885391 6:20046476-20046498 CCCAGAGCTCTGTCCTTGACAGG - Intergenic
1004900480 6:20188950-20188972 CCCACCTCTCAGTTCCTGAGGGG + Intronic
1005771628 6:29078899-29078921 CCCAGTCCTCCATCCCTGACAGG - Intergenic
1006364407 6:33606942-33606964 CCCAGCACCCAGGCCCTGAAGGG + Intergenic
1008418256 6:51268097-51268119 CCCAGATTTCAGTGCCTGTCTGG - Intergenic
1008647198 6:53527066-53527088 CACAGCTCATAGTCCCTGAAGGG - Intronic
1009305462 6:62083679-62083701 CACAGCTCTCAACCCCTCACAGG - Intronic
1012122041 6:95380827-95380849 CCTAGCCCCCACTCCCTGACAGG - Intergenic
1012740652 6:103012686-103012708 CCCACCCCTCACCCCCTGACAGG + Intergenic
1013998706 6:116340636-116340658 CCCAGCCCCCACCCCCTGACAGG + Intronic
1015455668 6:133424331-133424353 CCCAGCCTTCAGGCCCTCACTGG + Intronic
1016556106 6:145340675-145340697 CCCAGCACCCAGCCCCTAACTGG + Intergenic
1017919344 6:158857678-158857700 CCCAGATCTCAGTCCCTCAAGGG + Intergenic
1018143343 6:160861428-160861450 CCCCACTCTGAGTCCATGACTGG - Intergenic
1018143717 6:160864031-160864053 CCCCGCCCTGAGTCCATGACTGG - Intergenic
1018553081 6:165021115-165021137 TCCAGCCTTCAGTCCCTGATTGG + Intergenic
1019316864 7:390955-390977 CCCAGCTCTTACCCCCTCACAGG - Intergenic
1019698691 7:2461677-2461699 CCCAGCTCCCGCTCCCTGACAGG - Intergenic
1020933243 7:14427088-14427110 CCCACCCCCCACTCCCTGACAGG - Intronic
1022307004 7:29155886-29155908 CCCAGCTCACAGACCCTGACAGG - Intronic
1023280812 7:38567381-38567403 CCCAGCCCCCAACCCCTGACAGG - Intronic
1023660198 7:42463073-42463095 CCTAGCTTTCAGTACCTTACAGG - Intergenic
1024066109 7:45738047-45738069 CCCAGCCCTCCACCCCTGACAGG - Intergenic
1024354956 7:48405064-48405086 ACCAGCCCTCAGTGCCTCACTGG - Intronic
1025777813 7:64574612-64574634 CCCAGCCCAGAGTCCCTGATTGG - Intergenic
1026430429 7:70341591-70341613 CCCAGCTCTCATTAGCTGAATGG + Intronic
1026454306 7:70557366-70557388 CCCAGCTCCCAGCCCTTGGCTGG + Intronic
1027708582 7:81567525-81567547 CTCAGCTCTCAACCCCTCACAGG - Intergenic
1032250091 7:130248854-130248876 CCCAGCCCCCACCCCCTGACAGG + Intergenic
1032456219 7:132075359-132075381 ACCAGCTCCCCTTCCCTGACCGG + Intergenic
1035224407 7:157425516-157425538 CCCTGCTCTCAGGCCCCGCCTGG + Intergenic
1035742578 8:1939396-1939418 CCCGGCTCTCAGTCCCAGGATGG + Intronic
1036185030 8:6615173-6615195 CCCAGGTCTCAGGACCTGAGGGG + Intronic
1036522535 8:9505282-9505304 CCCAGCTGCCAGTCCCTTGCTGG + Intergenic
1038168811 8:25110184-25110206 CCCTGCTCCCAGCCCCTGGCTGG - Intergenic
1040518548 8:48154491-48154513 CCCAGCTCTCAGCCTCTCCCTGG + Intergenic
1041357286 8:57014209-57014231 CCCAGCTTTCAGGCCCTCCCTGG + Intergenic
1042180460 8:66082176-66082198 CCCAGTACTCAGTCACTGACAGG + Intronic
1042799980 8:72708024-72708046 CCCAGGTCTCAGCTCCTGTCTGG - Intronic
1043339937 8:79225573-79225595 CCCAGCCCTCCAACCCTGACAGG - Intergenic
1043515417 8:80990691-80990713 CCCAGCCCTCAGTATCTTACAGG - Intronic
1044186074 8:89253769-89253791 CCATGCTCTCAGACACTGACAGG - Intergenic
1044202248 8:89451356-89451378 CCCAGCTTTGGCTCCCTGACTGG + Intergenic
1044476611 8:92633692-92633714 CCCAGCTATGAGACCCTGATGGG + Intergenic
1045061618 8:98416215-98416237 TCCAGCTCTCAGTCCCTTCTGGG - Intronic
1045779569 8:105847933-105847955 CCCAGTTCACAGTTCCTGACAGG + Intergenic
1047013561 8:120698758-120698780 CCCTGCTTTCACTCCCTGCCTGG - Intronic
1050181457 9:2927368-2927390 CCTACCTCCCACTCCCTGACAGG - Intergenic
1050578927 9:7029710-7029732 CACAGCCCTCAGTCCCCGAAAGG - Intronic
1050623357 9:7477745-7477767 GCCAGCTCTCATTCGCTGAGAGG + Intergenic
1050672242 9:8010647-8010669 CCCACCTCTCATTTCCTGCCAGG + Intergenic
1050897607 9:10902674-10902696 CCCAGCCCCCACCCCCTGACAGG - Intergenic
1051054987 9:12974386-12974408 CCCAGTTTTCAGACCCTCACGGG + Intergenic
1052977413 9:34421483-34421505 CCCACCTGTCACTCCCTGGCTGG + Intronic
1055639666 9:78309707-78309729 CCTGGCTCTCATTCGCTGACTGG + Intronic
1056888025 9:90462732-90462754 CCTAGCCCCCACTCCCTGACAGG - Intergenic
1058896649 9:109406183-109406205 CCCAGCTCCCAGTTCCTCCCAGG - Intronic
1059297331 9:113283262-113283284 TCCAGCACTCAGTTCCTGAGAGG - Intronic
1061597144 9:131638587-131638609 GGCTGCTCTAAGTCCCTGACTGG + Intronic
1061994051 9:134175163-134175185 CCCAGCTCCCAGAACCTGAATGG - Intergenic
1062164765 9:135102085-135102107 CCCAGCTCCCAGCGGCTGACAGG - Intronic
1062710458 9:137972497-137972519 CCCAGCTCCCAGTTCCAGCCTGG + Intronic
1185505870 X:631930-631952 CCCAGCGCTCAGCGCCTGCCGGG + Intronic
1187314726 X:18182722-18182744 CCCACCTCTCAGCAACTGACAGG + Intronic
1189083574 X:37997769-37997791 CCCAGCTTTCAGGCCCTTCCTGG - Intronic
1190242204 X:48666185-48666207 CTCTGCTCTTAGTCACTGACTGG - Intergenic
1191785826 X:64916575-64916597 CCCAGGTCTCAGTACCTGGCTGG - Exonic
1192990701 X:76453467-76453489 ACCAGCTCACAGTCCTTAACAGG + Intergenic
1194380274 X:93181791-93181813 CCCAGCTTTCAGGCCCTCCCTGG - Intergenic
1199990234 X:152983687-152983709 CCCAGCCCTCAGTCTGTGGCAGG - Intergenic
1200839400 Y:7765153-7765175 CCCAGCCCTCACACCTTGACAGG - Intergenic