ID: 1070058015

View in Genome Browser
Species Human (GRCh38)
Location 10:72953953-72953975
Sequence TGTGAACTGCAGCAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070058003_1070058015 21 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG No data
1070058007_1070058015 7 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070058015 Original CRISPR TGTGAACTGCAGCAGGGGGA AGG Intronic
No off target data available for this crispr