ID: 1070058016

View in Genome Browser
Species Human (GRCh38)
Location 10:72953954-72953976
Sequence GTGAACTGCAGCAGGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070058007_1070058016 8 Left 1070058007 10:72953923-72953945 CCAGTCAGGGACTGAGAGCTGGG 0: 1
1: 0
2: 5
3: 18
4: 321
Right 1070058016 10:72953954-72953976 GTGAACTGCAGCAGGGGGAAGGG No data
1070058003_1070058016 22 Left 1070058003 10:72953909-72953931 CCAGCAAATTGATGCCAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1070058016 10:72953954-72953976 GTGAACTGCAGCAGGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070058016 Original CRISPR GTGAACTGCAGCAGGGGGAA GGG Intronic
No off target data available for this crispr