ID: 1070059344

View in Genome Browser
Species Human (GRCh38)
Location 10:72967366-72967388
Sequence GGCCTGGCAGAACACCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070059344_1070059351 25 Left 1070059344 10:72967366-72967388 CCCAAGGGGTGTTCTGCCAGGCC No data
Right 1070059351 10:72967414-72967436 AGAGCTCTTCAGTCAGCTTGTGG 0: 13
1: 141
2: 318
3: 474
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070059344 Original CRISPR GGCCTGGCAGAACACCCCTT GGG (reversed) Intergenic
No off target data available for this crispr