ID: 1070063350

View in Genome Browser
Species Human (GRCh38)
Location 10:73008071-73008093
Sequence AATTGTCCACAGATGAAACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070063348_1070063350 -9 Left 1070063348 10:73008057-73008079 CCCACAAAGTAAGCAATTGTCCA 0: 1
1: 1
2: 2
3: 15
4: 205
Right 1070063350 10:73008071-73008093 AATTGTCCACAGATGAAACATGG 0: 1
1: 0
2: 1
3: 15
4: 200
1070063349_1070063350 -10 Left 1070063349 10:73008058-73008080 CCACAAAGTAAGCAATTGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1070063350 10:73008071-73008093 AATTGTCCACAGATGAAACATGG 0: 1
1: 0
2: 1
3: 15
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070063350 Original CRISPR AATTGTCCACAGATGAAACA TGG Exonic
902596569 1:17513763-17513785 AACTGTCCCCAGATGTTACATGG + Intergenic
907059379 1:51405794-51405816 AATTGTCCTCAGATGAGGCAAGG + Intronic
908100296 1:60784183-60784205 AATTGTAAACAGAAGGAACAAGG - Intergenic
910024120 1:82628493-82628515 AATTGGTCACAGATGACACCAGG - Intergenic
910291396 1:85603390-85603412 AATTGTCCACAGATGATGACTGG - Intergenic
915255426 1:154625131-154625153 CATTGTCCAGATATGAACCAAGG - Intronic
916504001 1:165411242-165411264 GAATGTTGACAGATGAAACAAGG + Intronic
919899182 1:202031294-202031316 CATTGTCTAAAGATGAATCAAGG + Intergenic
921053295 1:211526427-211526449 AATTTTTCACAGATGACCCAGGG + Intergenic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
923069062 1:230546272-230546294 AATTGTCCCCAACTGAGACAAGG - Intergenic
924349308 1:243099954-243099976 CACTGTCCAGAGATGCAACACGG - Intergenic
1063981133 10:11452757-11452779 AAGTGCCCCCAGATGAAATATGG - Intergenic
1065045227 10:21741639-21741661 ACTTTTCCACAGAAGTAACATGG - Intronic
1066727058 10:38404967-38404989 CACTGTCCAGAGATGCAACACGG + Intergenic
1067415761 10:46101070-46101092 AATTTTCCACAAATGAAGCTGGG - Intergenic
1067971163 10:50972589-50972611 TATTTGCCACAGCTGAAACATGG + Intergenic
1068299471 10:55120108-55120130 AATTGACAACAGAGGAAACAGGG + Intronic
1068442791 10:57080355-57080377 AAATGACCACAGAAGAAAGAAGG - Intergenic
1068521792 10:58085173-58085195 TAATGTCCACAAATGAGACAGGG - Intergenic
1070063350 10:73008071-73008093 AATTGTCCACAGATGAAACATGG + Exonic
1078473005 11:11606689-11606711 GTTTGTCCTCAGATGAAACCAGG - Intronic
1078765466 11:14292766-14292788 AAATGTCCACTGATGAAACTTGG - Intronic
1079510746 11:21206856-21206878 AAGTGTCTAAAGATGAAACATGG - Intronic
1081678106 11:44982793-44982815 CATGGTCCACAGATGCAACTGGG - Intergenic
1082650520 11:55786148-55786170 AGTTGACCACAACTGAAACATGG - Intergenic
1083258373 11:61510070-61510092 AATTGCCCACAGATCAGCCAGGG - Exonic
1084259007 11:67962346-67962368 ACTTGGTCACAGAGGAAACAGGG + Intergenic
1085204989 11:74726273-74726295 AATTTCCCACAAAGGAAACAGGG - Intronic
1085994709 11:81897024-81897046 AATTAACCACAGATAAGACATGG + Intergenic
1086827931 11:91522618-91522640 AATTGTCCACACAGGAGCCAAGG - Intergenic
1087503725 11:98993671-98993693 GATTGTACTCAGATGAAATAAGG + Intergenic
1088014914 11:105046713-105046735 AATTGTACACAGAGGAGCCAGGG + Intronic
1088552524 11:111027417-111027439 AATTATCCAGAGCTGAAGCAAGG + Intergenic
1088825881 11:113493989-113494011 ACTTGCACACAGATGAAATATGG + Intergenic
1088977732 11:114830704-114830726 ATTTGTCCAGAGATCACACATGG + Intergenic
1089931767 11:122320001-122320023 ATTTGTCTAAAAATGAAACAAGG + Intergenic
1092572851 12:9744258-9744280 AATTGTCCTCAGTGGAAAGAGGG - Intergenic
1093450125 12:19305014-19305036 ATGTGTCCACACATGAAAAAAGG - Intronic
1093805409 12:23426621-23426643 AGTTGTCGAAAGATGATACATGG - Intergenic
1094563004 12:31573654-31573676 AATTGTCCATTGAAGAATCATGG - Intronic
1095270446 12:40212409-40212431 AATTGTCCATAGATGACAAAAGG - Intronic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1095621990 12:44267890-44267912 AAATGTCCACTGATGAATAATGG - Intronic
1096802392 12:54119798-54119820 AATTGACCCCAGATGGAATAGGG + Intergenic
1097680822 12:62647445-62647467 AATGGTCCCCAGATGAGCCATGG + Exonic
1098430873 12:70418697-70418719 CAATGTGCACAGATGAAATATGG - Intronic
1098762555 12:74443327-74443349 AGTTGTCCAGAATTGAAACAAGG + Intergenic
1099470807 12:83045816-83045838 AATTGTTCACAGGTGGCACAAGG + Intronic
1103504130 12:121429505-121429527 AATTCTCTACAGAGGAAACTTGG + Intronic
1104234325 12:126918228-126918250 CATGGTCCACAGAGGATACATGG - Intergenic
1104361277 12:128135521-128135543 GATTTTTCACAGATGAAGCAGGG - Intergenic
1104718902 12:131033762-131033784 AAATGACCACAGAGGACACACGG - Intronic
1107766085 13:43736260-43736282 AATTGTCAACAAATGAAACATGG + Intronic
1108959629 13:56208564-56208586 AATTGACCACAGATGACACTGGG + Intergenic
1113125273 13:106971411-106971433 AATGGGCCACAGATGGAAGATGG + Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114770425 14:25424693-25424715 AAATGTCCACAGAAGAAAGCAGG + Intergenic
1117187544 14:53256292-53256314 AATTGTCCATAGATGACAAAAGG + Intergenic
1117248859 14:53915269-53915291 AAGGTTCCACAGCTGAAACATGG + Intergenic
1118510735 14:66470082-66470104 AATTGTCCATGGATGACAAAAGG - Intergenic
1119417749 14:74485557-74485579 TATAGTCCAGAGAGGAAACAGGG + Intronic
1120450425 14:84659712-84659734 AATTGCCCTCATCTGAAACATGG + Intergenic
1121597386 14:95175425-95175447 AATTATACATAGATAAAACAAGG + Intergenic
1122433866 14:101678484-101678506 AATTGTCCACGGATGACAAAAGG + Intergenic
1124477176 15:30045205-30045227 AGTTGTCCACAGATGCACCTGGG - Intergenic
1127058851 15:55161618-55161640 CATAGTCCAGAGCTGAAACAGGG - Intergenic
1129595655 15:76962127-76962149 AGCTGTTCACAGGTGAAACATGG + Intergenic
1131293721 15:91129399-91129421 AATTGTCCGGAGATGGAACTGGG + Intronic
1137280026 16:46968621-46968643 AATTGTCCATGGAGGAAACAGGG - Intronic
1138715349 16:59015912-59015934 AACTGTCCAGAGTTGAAACATGG + Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1148286882 17:46401438-46401460 AGTTGTCCAGGGATGGAACAGGG + Intergenic
1148309051 17:46619028-46619050 AGTTGTCCAGGGATGGAACAGGG + Intronic
1148486287 17:47993028-47993050 AATTGGCCCCATATAAAACAAGG + Intergenic
1149064471 17:52463867-52463889 AATTGTAAAAAGATGATACAAGG - Intergenic
1149203004 17:54209941-54209963 CATTGACCACAGAATAAACAAGG + Intergenic
1152078349 17:78171846-78171868 AGTTGTCCACAGATGCACCTGGG - Exonic
1154143084 18:11842879-11842901 AATAGTCAACAGTTGAAAGAAGG - Intronic
1155104139 18:22643905-22643927 AATTTACCACAACTGAAACAAGG + Intergenic
1155175332 18:23296809-23296831 ACTTATCCCCAGAGGAAACAGGG - Exonic
1155705591 18:28806766-28806788 AATTGTCTACAGATTAGACTAGG + Intergenic
1157831951 18:50864202-50864224 AATTGCTGACAGATAAAACAGGG + Intergenic
1157848560 18:51026896-51026918 AATTGTGCAGAGATGAAGCGGGG + Intronic
1158352286 18:56575031-56575053 AACTGTCCAGAGGTCAAACAAGG + Intergenic
1159057863 18:63484300-63484322 AATTGATCTCAGAAGAAACAAGG - Intronic
1159142585 18:64415448-64415470 ATTTGTCCATAGATGAAAGTTGG + Intergenic
1160752851 19:742794-742816 AACTGTCTACAGATGGAAGAAGG - Intronic
1168005124 19:53480711-53480733 AGATGTCCACAGATGACATAAGG - Intronic
925532564 2:4881045-4881067 AATTGTAAACAAATGGAACATGG - Intergenic
925812262 2:7712172-7712194 AATTGGCCAGAGATGAAGAAAGG - Intergenic
925959116 2:8998652-8998674 AACTGTCCAAAAAGGAAACAAGG + Intronic
927934166 2:27066318-27066340 AATAGTAGAAAGATGAAACAAGG + Intronic
929571241 2:43024431-43024453 AAGTGTCCACTGATAGAACAGGG + Intergenic
930414514 2:51074477-51074499 ATCTGTACACAGATGAAAAAAGG - Intergenic
930678907 2:54234421-54234443 AATTGTAAAGAGATGAATCATGG - Intronic
933114776 2:78454621-78454643 AACTGTCCACAGAAGAAATGTGG - Intergenic
933530278 2:83501014-83501036 TATTGTCCACTCATGAAAAATGG - Intergenic
935515206 2:104027800-104027822 AATTGTCCATAACTGAAACTTGG - Intergenic
935899572 2:107776374-107776396 AATTTTACAAAAATGAAACATGG + Intergenic
936388347 2:112050615-112050637 AATTGTCCAAAGAACAAATAAGG - Intergenic
936596751 2:113855391-113855413 TCTTGTCCACAGATCAACCATGG + Intergenic
936987017 2:118321177-118321199 AAGTGTCTGCAGATAAAACAAGG - Intergenic
937512306 2:122609852-122609874 AGAAGTCCACAGAGGAAACAAGG + Intergenic
937797202 2:126037818-126037840 AATTGTGCACAGCTGAAAATGGG - Intergenic
938250343 2:129810955-129810977 CATTCTCCATAGATCAAACAGGG - Intergenic
939228897 2:139400590-139400612 AATTCTCCACAAATAAAACATGG + Intergenic
942306858 2:174617089-174617111 AATTATCCCCACATGTAACATGG - Intronic
942308397 2:174631217-174631239 AAATGTCCACTGATGAATGAAGG + Intronic
944268188 2:197751174-197751196 AAATGCCCACAGAAGAAAGAGGG + Intronic
945053537 2:205848430-205848452 AATTCTGCACAGATAAAACCAGG + Intergenic
948555200 2:238804796-238804818 AATTGTCCCCAGATGTGACCTGG - Intergenic
1170255088 20:14333208-14333230 TATTTTCCATAAATGAAACAAGG - Intronic
1170332629 20:15231175-15231197 AATTATCCAAAGATTAAAAAGGG - Intronic
1177423226 21:20889581-20889603 AATTTTCAACATATGAAACCTGG - Intergenic
1179074068 21:38101513-38101535 AATGGACCAAAGAGGAAACAAGG + Intronic
1181923696 22:26340993-26341015 AGCTGACCACAAATGAAACATGG - Intronic
1182509737 22:30810362-30810384 AAGTGTACACAGAAGACACAAGG - Intronic
1182681834 22:32085515-32085537 AATTGTCGACATAAGAAACCAGG - Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
950501830 3:13369215-13369237 ATTTGTCCAAAGCTGATACACGG - Intronic
950978306 3:17274246-17274268 AATTGACCTCTGATTAAACAAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953500363 3:43427188-43427210 ACTTGTCCACAGGTGGCACAAGG + Intronic
956597498 3:70983907-70983929 AATTCTCCACAGAGTAAGCACGG + Intronic
957037739 3:75310811-75310833 AATTGTTCAAAGATGACACTAGG + Intergenic
959922891 3:111889229-111889251 TACTGTACACTGATGAAACAAGG + Intronic
959980470 3:112510596-112510618 AATTGTCCAAGGATGACAAAAGG + Intergenic
960841413 3:121963094-121963116 AATTGTCCAAAGAGCAAAGATGG - Intergenic
961085773 3:124066366-124066388 AATTGTTCAAAGATGACACTAGG + Intergenic
964559210 3:157975106-157975128 AATTGACTACAGATGAACTATGG + Intergenic
964568064 3:158080078-158080100 AGTTTTCTAAAGATGAAACAGGG - Intergenic
965239422 3:166175961-166175983 ATATTTCCACAGGTGAAACAAGG + Intergenic
970559454 4:17268517-17268539 TATTGTCCAAAGAGGACACATGG - Intergenic
974730335 4:65856089-65856111 AATTGACCAAAAATGAAACTTGG - Intergenic
975096086 4:70458348-70458370 AATAGTGCACAGGTGATACAAGG + Intronic
975391603 4:73824217-73824239 AAATGTCCACAATTGAAAAATGG - Intergenic
976906683 4:90245369-90245391 TAGTGTCCTCAGCTGAAACAAGG + Intronic
977053464 4:92160005-92160027 AGTTTTCAACAGATAAAACATGG - Intergenic
977790456 4:101094298-101094320 AATTCTCAATAAATGAAACAGGG - Intronic
978084464 4:104633430-104633452 AGTTGTCCATGGAAGAAACAAGG + Intergenic
978233978 4:106435273-106435295 AACTGTCAACAGCTGAAACAGGG - Intergenic
979254059 4:118593551-118593573 CACTGTCCAGAGATGCAACACGG + Intergenic
979334922 4:119452796-119452818 CACTGTCCAGAGATGCAACACGG - Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
981158154 4:141464466-141464488 AATTAACCACAGCTGAAAGACGG + Intergenic
981636416 4:146885955-146885977 AATTCACCAAAGATGAAATATGG - Intronic
981959405 4:150517844-150517866 AATTGTCATCAGTTGGAACATGG + Intronic
982475771 4:155848613-155848635 AATTGTCCTTGGATGAAAAAAGG - Intronic
984041023 4:174733846-174733868 ATGTGGCCACAGAAGAAACAGGG - Intronic
984613945 4:181874365-181874387 AAATGTCGACAGAAGAAAAAAGG - Intergenic
985983773 5:3495526-3495548 AAATATTCACAGATGAGACAAGG - Intergenic
986753307 5:10810483-10810505 AATTGTCCACGGAAGAAACCAGG + Intergenic
988152794 5:27408254-27408276 AATTGTCCAATGAAGAAACCAGG + Intergenic
991037797 5:62145286-62145308 AATTGTCCTCAGTTCAAATATGG + Intergenic
991107806 5:62862869-62862891 ATTTTTCCAAAGATGATACATGG - Intergenic
997883879 5:137613862-137613884 AAGTGGCCACAGGTGAAACCAGG + Intergenic
999888689 5:155952833-155952855 AAATGTGCCCAGATGAAAAATGG + Intronic
1000581907 5:163045367-163045389 AACTGGATACAGATGAAACATGG + Intergenic
1002770388 6:285810-285832 AACTGTACATTGATGAAACAGGG + Intergenic
1004007591 6:11651466-11651488 CATTGTCCAGAACTGAAACATGG + Intergenic
1005050304 6:21677961-21677983 AATTGACCACAGTGGACACAAGG - Intergenic
1006274944 6:32996788-32996810 AATGTTCCACTGATGAAAAAAGG - Intergenic
1008440360 6:51525785-51525807 AATTGCCTACAGATTATACAAGG + Intergenic
1010490824 6:76475000-76475022 AATTGTCAACAGAGGAAAGGAGG - Intergenic
1010642566 6:78347204-78347226 AAATGTCAAAAGGTGAAACAGGG + Intergenic
1011004729 6:82631414-82631436 AGTTGTCCAAGGATGAAACTAGG + Intergenic
1012474401 6:99604371-99604393 AATTGTCCACAAAGGAGAAAAGG - Intergenic
1015656517 6:135524926-135524948 AATTGACCACAGTTGAAGAAAGG - Intergenic
1015752069 6:136570251-136570273 TACTGTCCACAGATCAAATAGGG - Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017351259 6:153444660-153444682 AATTGTCCATGGATAAAAAAAGG + Intergenic
1018145814 6:160887481-160887503 AATTGTCCATGGATGAAAAAAGG - Intergenic
1019832551 7:3347560-3347582 AATTGGTCAGAAATGAAACAGGG - Intronic
1021777691 7:24069772-24069794 TATTGTTCACTGATGAACCAAGG + Intergenic
1021915514 7:25428120-25428142 AACTGTCCAAGAATGAAACAGGG - Intergenic
1022910703 7:34897624-34897646 AAAAGTCCACAGATTAAAGATGG + Intergenic
1023006154 7:35869788-35869810 AATTATACATAGATGATACATGG + Intronic
1024069132 7:45770884-45770906 CACTGTCCAGAGATGCAACACGG + Intergenic
1028603440 7:92628613-92628635 AATTACCCAGAGATGAACCAAGG - Intronic
1035789162 8:2288286-2288308 AGTTGTCCACCAATAAAACAGGG - Intergenic
1035803643 8:2433419-2433441 AGTTGTCCACCAATAAAACAGGG + Intergenic
1035911304 8:3569870-3569892 AAATGTTCAGAGAAGAAACAAGG - Intronic
1036052740 8:5218048-5218070 AATTGTGTACAGATGTAATATGG - Intergenic
1036952146 8:13150996-13151018 AGATGTCTACAGATGGAACAGGG + Intronic
1037420428 8:18696047-18696069 AATTGCCCTGAGATGAAAAAAGG + Intronic
1038891308 8:31727591-31727613 AATTGACTACAGTTGAGACAGGG - Intronic
1039407712 8:37327230-37327252 AGTTGTAAACAGATGGAACAAGG - Intergenic
1042706959 8:71673925-71673947 AATTGTTCAAAGATTACACATGG + Intergenic
1043467348 8:80524795-80524817 AATTATCCAAAGATGAAATGGGG + Exonic
1043593394 8:81855947-81855969 CACTGTGCACAGATGAAACATGG - Intergenic
1043783061 8:84361432-84361454 AATTGTACAGAGAAGAAACTGGG + Intronic
1044374259 8:91450812-91450834 AAATTTCCACAGATGAAATTGGG + Intergenic
1045599466 8:103696062-103696084 AATTGTTCACAGAAAAAAAATGG - Intronic
1046978506 8:120311035-120311057 AATTGGAAACAGATGAAGCAAGG + Intronic
1048747119 8:137626425-137626447 TATTGTTCCCAGATGAGACATGG + Intergenic
1052228241 9:26116057-26116079 AATTGGCCAAAGATGATAGAGGG - Intronic
1052404998 9:28048227-28048249 AATAATCCACAGAAGAAACTCGG + Intronic
1052460142 9:28752525-28752547 AATTTTCCACAGAAGAAATTTGG + Intergenic
1055623652 9:78150600-78150622 AGTTGTCCACAGATGCACCTGGG + Intergenic
1055792691 9:79939736-79939758 AATTATCTTCTGATGAAACAGGG - Intergenic
1056849191 9:90067229-90067251 AATTGATCCCAGAAGAAACAAGG + Intergenic
1058756935 9:108091366-108091388 AAATGTCTTCAGATGACACAGGG - Intergenic
1061369091 9:130187839-130187861 AATTGTTCACAGAAGCCACACGG - Intronic
1187215648 X:17273525-17273547 AATTCTCCACAAAAGAAACCAGG - Intergenic
1188790491 X:34403516-34403538 ACTTTTCTACAGATGAAAAATGG - Intergenic
1189742382 X:44133249-44133271 AATTAACCCTAGATGAAACATGG - Intergenic
1191600167 X:62994987-62995009 AATTGTACAAGGATGTAACAGGG - Intergenic
1192199046 X:69052491-69052513 AATTGTCCAAAGCAGAAACCTGG - Intergenic
1192563783 X:72145751-72145773 AAAAGTCCACAGAAGTAACAAGG - Intergenic
1193310064 X:79996636-79996658 AATTTTCCACAGAAGTGACAAGG + Intergenic
1193331441 X:80239253-80239275 AATTGGTCACAGCTGAAACCAGG - Intergenic
1193754795 X:85395228-85395250 AGTTGTCCAAAGAAGAAAAATGG - Intergenic
1197239787 X:124111008-124111030 AATTGTTGATATATGAAACATGG - Intronic
1198940536 X:141951249-141951271 AATTCTCCAAAGATGAGAAAAGG - Intergenic
1199114490 X:143975051-143975073 TATTATTCACATATGAAACAGGG + Intergenic
1202040467 Y:20677488-20677510 AAATGTCCACAAAAGAAAGAAGG + Intergenic