ID: 1070063591

View in Genome Browser
Species Human (GRCh38)
Location 10:73010800-73010822
Sequence GTGAGCCATGTTTATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070063586_1070063591 24 Left 1070063586 10:73010753-73010775 CCACTATTTGGGAGGCTGAGGCT 0: 1
1: 32
2: 584
3: 1967
4: 3934
Right 1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 136
1070063589_1070063591 -3 Left 1070063589 10:73010780-73010802 CCCAGGAGGTCAAAGCTGCAGTG 0: 206
1: 4073
2: 14881
3: 32179
4: 76354
Right 1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 136
1070063590_1070063591 -4 Left 1070063590 10:73010781-73010803 CCAGGAGGTCAAAGCTGCAGTGA 0: 232
1: 4432
2: 13865
3: 30985
4: 87354
Right 1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 136
1070063583_1070063591 26 Left 1070063583 10:73010751-73010773 CCCCACTATTTGGGAGGCTGAGG 0: 11
1: 311
2: 8313
3: 124613
4: 345656
Right 1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 136
1070063585_1070063591 25 Left 1070063585 10:73010752-73010774 CCCACTATTTGGGAGGCTGAGGC 0: 103
1: 6078
2: 103820
3: 286502
4: 432428
Right 1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070063591 Original CRISPR GTGAGCCATGTTTATACTGC TGG Intronic
902839829 1:19067736-19067758 GTGAGGCATGGTGATCCTGCTGG + Intergenic
903104697 1:21066102-21066124 GTGAGCCATGATCATACCACTGG + Intronic
906210439 1:44009869-44009891 GTCAGCCATGTTTGTACAGATGG + Intronic
912448973 1:109758168-109758190 GAGAGGCTTGTTTATACTCCAGG - Intronic
915389146 1:155525189-155525211 GTGAGCCATGTTCATGCCACTGG + Intronic
917710605 1:177680415-177680437 GTGAGCCAGGTGAATAGTGCTGG - Intergenic
917972147 1:180215458-180215480 GTGAGCCATGATTATACTACTGG + Intergenic
918816864 1:189197421-189197443 GTGTGCCATGGGTTTACTGCTGG - Intergenic
919316116 1:195971955-195971977 GTGAGTCATGTTTCCACTGAGGG + Intergenic
919615405 1:199802075-199802097 GTAAGCCATGTTTAAATTTCTGG - Intergenic
924792478 1:247265764-247265786 GTGAGCCAAGCTCATACTACTGG - Intergenic
1064732767 10:18349508-18349530 TTGAGCCAGGTTTATGCTGCTGG - Intronic
1064779313 10:18816985-18817007 GTGAGCCATGTTCACACGACTGG - Intergenic
1067693057 10:48516470-48516492 GTGAGCCATGATTGTACCACTGG + Intronic
1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG + Intronic
1071930812 10:90467466-90467488 GTAAGCCAGTTTTATACTGAGGG + Intergenic
1072521922 10:96236768-96236790 GTGAGCCATGATTGTACCCCTGG + Intronic
1073716588 10:106114893-106114915 GTCTGCCATGTTTTTCCTGCTGG + Intergenic
1081809737 11:45908106-45908128 GTGAGCCAGGTTCGCACTGCAGG - Intergenic
1082041444 11:47688720-47688742 TTGAGACCTGTTTTTACTGCTGG - Intronic
1087853389 11:103059971-103059993 GTTAGACTTTTTTATACTGCAGG + Intergenic
1088059476 11:105629183-105629205 GTGAGCTATGATTGTACTCCAGG + Intronic
1095443495 12:42261187-42261209 GTGAGCCATGTTTGTGCCACTGG - Intronic
1096061451 12:48703868-48703890 GTGAGCCATGATCACACTACTGG + Intronic
1098254128 12:68599344-68599366 GTGAGCCATGATTATGCCTCTGG - Intergenic
1102400827 12:112628218-112628240 GTGAGGCATGTTAATAATGAGGG + Intronic
1102780284 12:115558373-115558395 ATTAGACATGTTTCTACTGCAGG - Intergenic
1104117050 12:125759826-125759848 TTGACCCATGTTTATTCTGATGG + Intergenic
1106130478 13:26935325-26935347 GTGAGCCAAGATTATGCTGCTGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107489935 13:40872084-40872106 GTGAGCCATGCTTATACCACTGG - Intergenic
1107903337 13:45039910-45039932 GTGAGCCATGTTGACGCTACTGG + Intergenic
1109668529 13:65571451-65571473 GTGAGCCATGATTGTACCACTGG + Intergenic
1109697838 13:65983859-65983881 GAGAGCCAGATTTATCCTGCAGG - Intergenic
1110115086 13:71804255-71804277 GTGAGCCATGTTCGTACTACTGG + Intronic
1116817934 14:49599980-49600002 GTGAGCCATGATGCTGCTGCCGG - Intronic
1120335912 14:83154853-83154875 GTGAGCTATGATTGTGCTGCTGG - Intergenic
1120957633 14:90097007-90097029 GGCAGCCATGTTTGTGCTGCTGG - Intronic
1121260061 14:92559481-92559503 ATGAGCCATGTTTATAAAGATGG + Intronic
1124172693 15:27390513-27390535 ATGAGCCCTGTTTCTATTGCTGG - Intronic
1125620685 15:41059005-41059027 GTGAGCCATGTTCACGCTGCTGG - Intronic
1131479914 15:92771966-92771988 GTGAGCCGTGTTTGTACCACTGG - Intronic
1133391503 16:5414008-5414030 GTGAGTCATTTGTCTACTGCAGG + Intergenic
1137927816 16:52558014-52558036 GTGAGCCAAGATCACACTGCTGG - Intergenic
1138214822 16:55194593-55194615 GTGAGCCATGTTCATGCCACTGG - Intergenic
1142019550 16:87772744-87772766 GTGAGCCAAGATCATGCTGCTGG - Intergenic
1148704013 17:49611936-49611958 GTGAGCCATGATCATGCTACTGG - Intronic
1149624716 17:58072782-58072804 GTGAGCCATGATCACACTACTGG + Intergenic
1149904206 17:60510345-60510367 GTGAGTCATGATTATACCACTGG + Intronic
1153885350 18:9459454-9459476 GTGGCCCATGTTTATAGTCCTGG + Intergenic
1163506471 19:17710110-17710132 GTGAGCCATGATCATGCTCCTGG + Intergenic
1164040676 19:21490077-21490099 GTGAGCTATGTTTATATGGAAGG - Intronic
1165762722 19:38331272-38331294 GTGAGCCATGATCACACTACTGG + Intergenic
1168352087 19:55681861-55681883 GTGAGCTATGACTGTACTGCTGG - Intronic
1168646908 19:58065247-58065269 GTGAGCCATGATCATACCACTGG - Intronic
926006568 2:9377637-9377659 TTGAGCCATGTGTGTACTGGAGG + Intronic
927298642 2:21484600-21484622 GTGAGCCATGATCATACCACTGG + Intergenic
929715788 2:44308076-44308098 TTGAGCCATGATTACACTCCAGG + Intronic
930391366 2:50765546-50765568 GTGAGCCATGTGCATGCTCCAGG + Intronic
930840267 2:55837726-55837748 GTGAGCCAAGATTGTACCGCTGG - Intergenic
931063541 2:58558143-58558165 CTTAGCCTTGTTGATACTGCAGG - Intergenic
932676389 2:73785232-73785254 GTGAGCCATGTTCATACCACTGG + Intronic
932676975 2:73790133-73790155 GTGAGCCATGTTCATACCACTGG + Intronic
932677560 2:73795030-73795052 GTGAGCCATGTTCATACCACTGG + Intronic
932678146 2:73799928-73799950 GTGAGCCATGTTCATACCACTGG + Intronic
932678732 2:73804828-73804850 GTGAGCCATGTTCATACCACTGG + Intronic
942337108 2:174900446-174900468 GTGAGCTATGATCATACTCCAGG + Intronic
943518771 2:188920639-188920661 GTGAGCCATGATTATTCCACTGG + Intergenic
944230009 2:197383096-197383118 GTGAGCCATGATTGTACCACTGG + Intergenic
944815836 2:203374101-203374123 GTGAGCCATGTTCATGCCACTGG + Intronic
945603386 2:211895311-211895333 GTGAGCCATGATTGTACCACTGG - Intronic
947194961 2:227553438-227553460 GTGAGCCATGATCATGCTACTGG + Intronic
947226584 2:227846332-227846354 GTGAGCTATGATCACACTGCTGG - Intergenic
948917302 2:241040930-241040952 GAAAGCCATTTTTATACTGTAGG - Intronic
1168940443 20:1706948-1706970 GTGACCCATGTTTTCACTACAGG + Intergenic
1172947941 20:38703067-38703089 GTGAGCCATGTGGATGCTGGAGG + Intergenic
1175160412 20:57003890-57003912 GTGAGACATATTTATATTGTGGG - Intergenic
1182880275 22:33727061-33727083 GGGAGCCTTGTTTCTGCTGCCGG - Intronic
949451282 3:4188074-4188096 GTGAGGGATGTTGATAATGCGGG - Intronic
952482151 3:33772504-33772526 GTGAGCCATGATTATGCTACTGG + Intergenic
952537490 3:34326911-34326933 GGGAGCCATGTTTCTCCTACAGG - Intergenic
952690463 3:36199128-36199150 GTGAACCATTTTTATAGTGATGG + Intergenic
953828073 3:46271381-46271403 GTGGGCCAGGTTTGTCCTGCAGG - Intergenic
956436731 3:69241538-69241560 GTAAGCCTTCTTTATTCTGCTGG + Intronic
957325098 3:78681494-78681516 GCAATCTATGTTTATACTGCAGG + Intronic
957544066 3:81614068-81614090 GTGAGCCATGATTACACCACTGG - Intronic
957962704 3:87279222-87279244 GGGAACCATCTTTATACTTCTGG - Intergenic
962061559 3:131932963-131932985 GTGAGCCATGATTGTGCTCCTGG + Intronic
962724411 3:138208409-138208431 GTGAGCCAAGATCATGCTGCTGG + Intronic
965651600 3:170939160-170939182 GTGAGCCAAGATTATACCACTGG - Intergenic
972241184 4:37194314-37194336 GGAAGCCAGGTTTGTACTGCTGG - Intergenic
972874514 4:43342214-43342236 TTAAGCCAAGTTTGTACTGCAGG - Intergenic
973991322 4:56410800-56410822 GTGTGGCAGGTTCATACTGCAGG - Intronic
974364486 4:60928287-60928309 GTGAGCCATGATTGTGCTACCGG + Intergenic
974929119 4:68341505-68341527 ATGGGCCATGTTTATCCTGTAGG - Intronic
978218597 4:106240054-106240076 TTGAGCCATGTTTGTATTTCTGG - Intronic
979569986 4:122210583-122210605 GTGACCCAAATTTATATTGCAGG + Intronic
979572611 4:122246831-122246853 CTGAGCCATGATTATCTTGCTGG + Intronic
981328061 4:143475086-143475108 GTGAACCATGTTTCCACTTCTGG + Intergenic
982107778 4:152025663-152025685 GTGAGCCATCTGTTTCCTGCTGG + Intergenic
986084408 5:4429678-4429700 ATGAGCCATGTTTTTAATGCTGG - Intergenic
988185100 5:27850066-27850088 TTGAACCATTTTTACACTGCAGG + Intergenic
988951857 5:36270544-36270566 GTGAGCTATGATTGCACTGCTGG - Intronic
988963453 5:36392170-36392192 GTGAGCCATCTATTTACTGCTGG - Intergenic
989143558 5:38226083-38226105 GTGAGCCATGATCAAACTTCTGG + Intergenic
991709466 5:69394108-69394130 GTGAACCATGTTTGTACCACTGG - Intronic
994131111 5:96228700-96228722 GTGAGTCATGTTAATATTGAGGG + Intergenic
996722733 5:126646167-126646189 GTGAGCCATGATCACACTACTGG - Intergenic
1001766694 5:174254201-174254223 GTGAGCAGTCTTTATGCTGCAGG + Intergenic
1003095671 6:3141324-3141346 GTTAGGCAGGATTATACTGCGGG + Intronic
1004003520 6:11618433-11618455 GTGAGCCCAGTTTAATCTGCAGG - Intergenic
1008462767 6:51794935-51794957 GTGACCCAACTTTATACCGCAGG - Intronic
1010372034 6:75121628-75121650 GTGAGTCATCTTATTACTGCTGG - Intronic
1013540843 6:111107450-111107472 GTTAGCCATTTGTAAACTGCTGG - Intronic
1014216012 6:118753472-118753494 GTGAGCCATGATTATGCCACTGG - Intergenic
1014421698 6:121253762-121253784 GTGGGACACTTTTATACTGCTGG + Intronic
1015486723 6:133779626-133779648 TAGAGCCATGTTTATAATACAGG + Intergenic
1015933189 6:138382836-138382858 GTGAGCCCTTTTCATACTGAAGG - Exonic
1018167097 6:161108373-161108395 GTGAGTCCTGTTTCTACTTCAGG - Intronic
1019649544 7:2149238-2149260 GTGTGCCTTGTTTATCCTGCAGG - Exonic
1023051145 7:36252304-36252326 GAGAGCCAGGTTTATTCTGGCGG + Intronic
1023127190 7:36966082-36966104 TAGAGCCATATTTTTACTGCAGG + Intronic
1026072234 7:67132164-67132186 GTGAGCCATGATCATACTTGTGG - Intronic
1030077621 7:105750093-105750115 TTGAACCATGTGTAGACTGCAGG + Intronic
1030291647 7:107878838-107878860 GTGAGTCATATGTCTACTGCTGG + Intergenic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1032015309 7:128376314-128376336 GTGAGGGATGTTTATAATGGGGG - Intergenic
1032190070 7:129759928-129759950 CTGAGCCAAGTTCACACTGCTGG + Intergenic
1032860770 7:135877125-135877147 GTCAGCCATGTTTTCACTGGGGG + Intergenic
1033316177 7:140299562-140299584 GTGAGCTATGATTATGCTGATGG - Intronic
1034142179 7:148831058-148831080 GTGGGCCATGATCATAGTGCTGG - Intronic
1038046123 8:23766932-23766954 TTGAGCCTTGTTGGTACTGCTGG + Intergenic
1038317822 8:26502513-26502535 GTGAGCCATGATCACACCGCTGG - Intronic
1038343972 8:26715035-26715057 GTGAGCCATGTTTGTGCCACTGG + Intergenic
1041229725 8:55737141-55737163 GTGCGCCATGTTTACACTTCTGG + Intronic
1042029425 8:64459599-64459621 GTGAGCCAAGATTGCACTGCTGG - Intergenic
1045101933 8:98853387-98853409 GTGAGCTCTGTTCTTACTGCTGG + Intronic
1047546349 8:125821341-125821363 GTGGCACACGTTTATACTGCTGG + Intergenic
1048321090 8:133400743-133400765 AGGAGCCATTGTTATACTGCAGG - Intergenic
1049980262 9:897534-897556 GTGAGCTATGATTACACTACTGG + Intronic
1053217505 9:36284399-36284421 GTGAGTCATCTTTTTGCTGCTGG + Intronic
1055715842 9:79117142-79117164 GTGAGCCATGTATACATGGCAGG + Intergenic
1056928879 9:90858181-90858203 GTGAGGCATGTTGACTCTGCTGG - Intronic
1057224955 9:93288192-93288214 GGGAGACTTGGTTATACTGCTGG + Intronic
1057248151 9:93476234-93476256 GTTATCCATGTTTATATTCCAGG + Exonic
1058378188 9:104349419-104349441 GTGAGCCATGATTACACCACTGG + Intergenic
1059500461 9:114748529-114748551 GTGATGCATGTTTATAGTACCGG - Intergenic
1186713510 X:12226158-12226180 GTGAGCCATGTTTGTGCCACTGG - Intronic
1187311101 X:18143710-18143732 GTGAGGGATGTTGATAGTGCGGG + Intergenic
1189052334 X:37659272-37659294 GTGAGCCATATTTGGCCTGCAGG + Intronic
1190324958 X:49200643-49200665 TTGAACCGTGTTTAAACTGCAGG - Intergenic
1194868786 X:99101645-99101667 GTGAGACCTGTTTAAACTGATGG - Intergenic
1198465793 X:136903705-136903727 GTGAGCCAAGATCATGCTGCTGG - Intergenic
1198548996 X:137725038-137725060 GTGAGCCATGATTGTACCACTGG - Intergenic