ID: 1070064268

View in Genome Browser
Species Human (GRCh38)
Location 10:73018216-73018238
Sequence TGGGTGGCCCAGACATCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070064268_1070064276 26 Left 1070064268 10:73018216-73018238 CCATGAGATGTCTGGGCCACCCA 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1070064276 10:73018265-73018287 CTGAAACAGCACATCACCCTTGG No data
1070064268_1070064278 28 Left 1070064268 10:73018216-73018238 CCATGAGATGTCTGGGCCACCCA 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1070064278 10:73018267-73018289 GAAACAGCACATCACCCTTGGGG No data
1070064268_1070064277 27 Left 1070064268 10:73018216-73018238 CCATGAGATGTCTGGGCCACCCA 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1070064277 10:73018266-73018288 TGAAACAGCACATCACCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070064268 Original CRISPR TGGGTGGCCCAGACATCTCA TGG (reversed) Intronic
900118756 1:1039835-1039857 TGGGTGCCCCAGGGATCCCAGGG + Intronic
900319535 1:2075757-2075779 TGGGTGCCCCAGACCTTCCACGG + Intronic
901500433 1:9649586-9649608 TGAGAGGCCCAGGCATCTCTTGG + Intergenic
902624654 1:17669610-17669632 TGGGGGGCCCAGGCACCCCAAGG - Intronic
902982957 1:20138801-20138823 TGGGTTGCTCAGACATCACCTGG - Intergenic
903375410 1:22862808-22862830 TGGGAGCCCTAGACAGCTCACGG + Intronic
903440373 1:23383656-23383678 CTGGTGGCCCAGACATCACATGG + Intronic
905769441 1:40627984-40628006 TGGATGGCCCAGACAGCCCCTGG + Intronic
913248488 1:116891596-116891618 TGGTTGGTCCAGAAATCTGAAGG - Intergenic
917465680 1:175273792-175273814 GGGATGGCCCAGATGTCTCAGGG + Intergenic
918411637 1:184264809-184264831 TGGTTGCCCAAGACCTCTCATGG + Intergenic
919318850 1:196008125-196008147 TATGTGGCCCAGACTTCTAAAGG + Intergenic
919761460 1:201100624-201100646 TGGGTGGGCCAGACACACCAGGG + Intronic
920384887 1:205564116-205564138 TGGATGGCCCAGCCATCCTAAGG - Intergenic
921600680 1:217103298-217103320 AGGGTTTCCCAGACAGCTCAGGG + Intronic
922223381 1:223625915-223625937 TGGCTGACCCTGACCTCTCAGGG + Intronic
922570215 1:226630174-226630196 TGGATGGCCCACCCTTCTCAAGG + Intergenic
922800882 1:228364305-228364327 GGGGTGGCCCTCTCATCTCATGG - Intronic
923520142 1:234728933-234728955 TCAGTGGCCCCGACACCTCAGGG - Intergenic
924874733 1:248089924-248089946 TGGGGGGCCCACACATCATAGGG - Intronic
1067109712 10:43391572-43391594 AGGCTGCCCCAGACATCTGAAGG - Intronic
1068515704 10:58022676-58022698 TGGTTGGACCAGAAATCTTAGGG + Intergenic
1069879794 10:71584841-71584863 TGGAAGCCCCAAACATCTCAGGG + Intronic
1070064268 10:73018216-73018238 TGGGTGGCCCAGACATCTCATGG - Intronic
1070648223 10:78216125-78216147 TGGGTGTCCCAGACATCATGTGG + Intergenic
1072743930 10:97926988-97927010 AGTGTGACCCAGGCATCTCAGGG - Intronic
1075575971 10:123577762-123577784 TGTGTGGCCCATGCATGTCACGG - Intergenic
1075658883 10:124179779-124179801 TGGGTGGACCAGATGTCCCAAGG - Intergenic
1077541927 11:3150712-3150734 TGGGTGTCCCAGGCAGCTCCTGG + Intronic
1079132113 11:17753154-17753176 GGGGTGGCCCAGACACCTTCGGG - Intronic
1079766325 11:24397732-24397754 AGGGTGGCCCAGACAAAGCAAGG - Intergenic
1084173845 11:67413303-67413325 TGAGGGGCCCACACATGTCAGGG - Intronic
1084550748 11:69840406-69840428 TGGGTTGCCCAGACCCCTCCAGG + Intergenic
1084790596 11:71473218-71473240 TGCGTGGCCCAGACAGGGCATGG + Intronic
1089355929 11:117853784-117853806 TGCCTGGCCCAGTTATCTCATGG + Intronic
1091974993 12:4817247-4817269 TGGGTTGCACAGATAGCTCATGG + Intronic
1096110023 12:49023090-49023112 TGGGTGGCACAGAGAGCCCAGGG + Intronic
1101693833 12:107106068-107106090 TAGGAGTCCCAGACATCTCTTGG - Intergenic
1102703205 12:114858183-114858205 TGGGTGGCCAAAAAATCACAAGG + Intergenic
1102963164 12:117106869-117106891 TGAGTGGCCCAGACCTCAGAGGG + Intergenic
1104756119 12:131270355-131270377 TGGGGTGCCCAGACTCCTCAGGG - Intergenic
1104777657 12:131400670-131400692 TGGGGTGCCCAGACTCCTCAGGG + Intergenic
1112282952 13:98078628-98078650 CAGCTGGCCCAGACATCTCCTGG - Intergenic
1115764398 14:36607980-36608002 AGGGTGGCACAGACATGTAATGG - Intergenic
1116806030 14:49494705-49494727 TGGCTGGCCAAGACTTCTCCTGG - Intergenic
1116989204 14:51256538-51256560 TAGGTGGCCCAGAATTCTCCAGG - Exonic
1117734124 14:58751941-58751963 TGGGTGGGGCAGACAGCTCCAGG - Intergenic
1119612137 14:76072414-76072436 GGTGTGACCCAGACATTTCAGGG - Intronic
1120025055 14:79573960-79573982 TGGGTTGCCCATACACTTCATGG - Intronic
1122783691 14:104154396-104154418 TGGGTGGCCCAGGGCTCCCAGGG + Intronic
1129359303 15:75014484-75014506 TGTGTGGCCCAGAAATCTTAGGG - Intronic
1131977879 15:97963615-97963637 TGGGTGGGCCCGACATCTTCAGG - Intronic
1132608085 16:801775-801797 GGGGTGGCCCAGACCTCTGCAGG + Intergenic
1136178944 16:28537974-28537996 CGGGGGGCCCAGAGAGCTCAAGG - Intronic
1137250365 16:46736750-46736772 AGGGTGGCCCTGACCTGTCACGG - Intronic
1138730768 16:59192293-59192315 TGTGTTGCACAGACAGCTCAAGG + Intergenic
1140543274 16:75780087-75780109 TGGTTTGCACAGACATCTCTAGG - Intergenic
1140811531 16:78583571-78583593 TGGGGGACCCTGACATTTCAAGG - Intronic
1143578300 17:7808038-7808060 TGGGTTGCCCAGACTCCTCACGG - Intronic
1144059434 17:11569319-11569341 TGGGTGATCAGGACATCTCAGGG - Intergenic
1144949123 17:18984645-18984667 CAGATGGCCCAGGCATCTCATGG + Intronic
1147287630 17:39415211-39415233 TGGGTGGCTAACACCTCTCATGG - Intronic
1148502852 17:48104886-48104908 TGGGAGGCCGAGACAGGTCAAGG - Intronic
1150449936 17:65258328-65258350 TGGATGACCCAGCCCTCTCAAGG + Intergenic
1151432152 17:74070965-74070987 TGCTTGGCCAAGACTTCTCAGGG - Intergenic
1151448473 17:74182383-74182405 AGGGTGGCCCAAACATGGCAGGG - Intergenic
1153630979 18:7069544-7069566 TGGGTGGCTCATACAGCACAGGG + Intronic
1158858510 18:61568974-61568996 TGGGTGGCTTAAAAATCTCATGG - Intergenic
1159925520 18:74265742-74265764 GGGGGAGCCCACACATCTCATGG + Intronic
1161103939 19:2434139-2434161 TGGGAGCCCCAGACAGCCCAGGG + Intronic
1162066620 19:8129625-8129647 TGGGTGCTACTGACATCTCATGG - Intronic
1163586477 19:18167094-18167116 GGGGTGGCGCAGAGACCTCAGGG - Intronic
1165144672 19:33723800-33723822 GGGGTGGCCCTGGCATCTCTGGG + Intronic
1166312309 19:41969753-41969775 CAGGTGGCCCACCCATCTCAGGG - Intronic
1167268499 19:48494948-48494970 TTTGTTGACCAGACATCTCAGGG + Intronic
926746344 2:16161500-16161522 TTGGTGGCCCAGACATTCCTTGG - Intergenic
928201603 2:29251001-29251023 TGGGGTGCCCAGGCATGTCAAGG - Intronic
929716176 2:44312587-44312609 TTGGTGGACCAGACAGTTCACGG + Exonic
929895668 2:45958592-45958614 TGAGAGGCCAGGACATCTCAAGG - Intronic
937291641 2:120785522-120785544 TGTGTGGCCCTGGCATCTCCTGG - Intronic
940859903 2:158760895-158760917 TTGGTGGCCCAGACATGCTAAGG - Intergenic
947739083 2:232476749-232476771 TGGGTATCCCAGAAATCCCAGGG + Intergenic
1169373063 20:5043458-5043480 AGGGTCACCCAGACATCTCTGGG + Intergenic
1171239292 20:23551946-23551968 AGGGAGGCCCAGAAAGCTCAGGG - Intergenic
1171333601 20:24362556-24362578 GGTGTGGCACAGACTTCTCAGGG - Intergenic
1173131744 20:40400350-40400372 TGGGTAGCCCAGACAAGACAAGG - Intergenic
1174160731 20:48548646-48548668 TGGGTGGCCCTCACAGTTCATGG - Intergenic
1175246420 20:57584973-57584995 GGGGTGGCCCAGGCAGGTCAGGG + Intergenic
1176423513 21:6533836-6533858 GGGCTGGGCCAGCCATCTCAAGG - Intergenic
1177625720 21:23656850-23656872 TGGGTGGCCCTGATGGCTCAAGG + Intergenic
1178706191 21:34875192-34875214 GGGGTGGCCCAGTCATGGCAAGG - Intronic
1179699007 21:43142152-43142174 GGGCTGGGCCAGCCATCTCAAGG - Intergenic
1181606483 22:23982864-23982886 TGAGTGGCCCCAACATCTGATGG - Exonic
1184106974 22:42373423-42373445 TGGGTGCCCTGGTCATCTCATGG + Intergenic
1184534239 22:45075890-45075912 TGGGTGGCAAAGACACATCAGGG + Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
950648749 3:14393981-14394003 CCGGTGGCCCAGACATCCCCAGG - Intergenic
950676542 3:14557571-14557593 TGGGTGGCAGAGGCCTCTCAGGG + Intergenic
950934392 3:16823938-16823960 CTGGTGGCCCAGGCCTCTCAGGG + Intronic
954388029 3:50254617-50254639 TGGCTGGGCCAGAGATCTCAGGG - Intronic
954465402 3:50651538-50651560 CGGCTGGCCCAGACTCCTCATGG - Intergenic
954972346 3:54661815-54661837 TGGTTCACACAGACATCTCAGGG + Intronic
956399526 3:68862137-68862159 GTGGTGGCCCAGACATCTAGTGG - Intronic
956794300 3:72704085-72704107 TGGGTGGCCCAGGGAGTTCACGG + Intergenic
961376110 3:126467168-126467190 AGGGTGGCCCAGTCACCTCGAGG - Intronic
964373248 3:156023621-156023643 TTGGCAGCCCAGTCATCTCAGGG + Intergenic
966266569 3:178053175-178053197 TGTGTGGCCCATACATCAAATGG - Intergenic
966619207 3:181945906-181945928 TGGGTTGCCTAGGCATATCAGGG - Intergenic
966649492 3:182283382-182283404 GGGGTGGCTCAGAACTCTCAGGG + Intergenic
968915805 4:3496614-3496636 TGGGTGGCCCGGAGATCTGGGGG + Intronic
968954921 4:3713347-3713369 TGTGTGTCCCAGGAATCTCAGGG + Intergenic
969300855 4:6296120-6296142 TTGGTGGCCCAACCATCTCCTGG - Intronic
972342186 4:38162151-38162173 TGGGTAGACCAGAGATCTCAAGG + Intergenic
974465093 4:62245182-62245204 TGGATGGACCAGACAGATCAAGG - Intergenic
984704058 4:182835060-182835082 TTCGTGGCCAAGACATCTCTGGG - Intergenic
985878589 5:2619874-2619896 TGGGTGGCACAGACCGCCCATGG - Intergenic
987262106 5:16214277-16214299 AGAGTGGCCCACATATCTCAGGG - Intergenic
988196466 5:28011974-28011996 TGGGAGGGCCAGTCATTTCATGG + Intergenic
990150320 5:52810214-52810236 TTGGTGGCACAGCCACCTCAGGG + Intronic
991682394 5:69152089-69152111 GCGGTGGCCCAGTCATTTCATGG + Intergenic
1000381633 5:160634897-160634919 TTGGTGGCACAGAGATCTAAAGG - Intronic
1001144939 5:169175705-169175727 TGGAAGCCACAGACATCTCAGGG - Intronic
1019476019 7:1244677-1244699 TGTGTGGCCCAGACACCCCCAGG - Intergenic
1019972201 7:4550122-4550144 TTGGTGTCCCAGACATGCCATGG - Intergenic
1022973924 7:35539880-35539902 TGGGTGGCTCTGACATCTTCAGG + Intergenic
1023352464 7:39334034-39334056 TGGGTGGCTCAGACAATACAAGG + Intronic
1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG + Intergenic
1030928877 7:115497175-115497197 TGGGTGGCCCAGGCATGTCTGGG + Intergenic
1035473747 7:159128244-159128266 TGGATGGGGCAGACATCCCAGGG - Intronic
1037650479 8:20833618-20833640 TTGGTGGTCCAAACATATCATGG - Intergenic
1037948729 8:23005262-23005284 TGGGGGCCCCAGACATCACTGGG - Intronic
1042866375 8:73359833-73359855 TGGTTGGCCTGCACATCTCATGG + Intergenic
1042987783 8:74603425-74603447 TCTGTGCCCCAGACATCTGACGG + Intronic
1048473160 8:134721178-134721200 TGAGTGGGCCAGGCAGCTCAGGG - Intergenic
1048706942 8:137164218-137164240 TGGAAGACTCAGACATCTCATGG + Intergenic
1049644355 8:143729398-143729420 TGGGTGATCCAGACACCTCCCGG - Intronic
1053533054 9:38900565-38900587 AGGTTGGCCCTGACATCACAGGG + Intergenic
1054205280 9:62124994-62125016 AGGTTGGCCCTGACATCACAGGG + Intergenic
1054633081 9:67463376-67463398 AGGTTGGCCCTGACATCACAGGG - Intergenic
1057151154 9:92797308-92797330 AGGTTGGCCCTGACATCACAGGG - Intergenic
1062338684 9:136083895-136083917 TGGCTGGCCCAGGCAGCTCTGGG + Intronic
1185635253 X:1547365-1547387 TGGGTGGCCTAGACAGCCCCAGG + Intergenic
1195273747 X:103257939-103257961 TGGGTCTCTCAGAAATCTCAGGG + Intergenic
1198109211 X:133487850-133487872 TGGGGGTCCCAGACATGCCATGG + Intergenic
1198330512 X:135618356-135618378 TGGGTGGGCCAGACCTGGCAGGG + Intergenic
1198336416 X:135670640-135670662 TGGGTGGGCCAGACCTGGCAGGG - Intergenic
1198363213 X:135915982-135916004 TGGGTGGGCCAGACCTGGCAGGG + Intergenic
1198492147 X:137152471-137152493 TGGGGAGCCCAGATATCCCAAGG - Intergenic
1198844346 X:140894184-140894206 TGGCTGGCTCAGTCCTCTCACGG + Intergenic