ID: 1070073818

View in Genome Browser
Species Human (GRCh38)
Location 10:73115788-73115810
Sequence GTTTAGTTCTTGGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070073818_1070073827 -2 Left 1070073818 10:73115788-73115810 CCCCCTTCCCCCAAGAACTAAAC 0: 1
1: 0
2: 1
3: 28
4: 226
Right 1070073827 10:73115809-73115831 ACTTCAGTGAAAGGTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070073818 Original CRISPR GTTTAGTTCTTGGGGGAAGG GGG (reversed) Intronic
900552149 1:3262293-3262315 GTGGAGTCCCTGGGGGAAGGAGG - Intronic
903638475 1:24838183-24838205 GTTTAGATCTTGGGGACAGAGGG - Intronic
908129264 1:61058272-61058294 TTTTAATTTTTGGAGGAAGGTGG + Intronic
908449985 1:64244413-64244435 TTTTAGTTCCTGGGGAGAGGAGG + Intronic
910681557 1:89870682-89870704 GTTGAATTCTGAGGGGAAGGTGG - Intronic
912236169 1:107853560-107853582 TTTTGGTTCTTGAGGGATGGGGG - Intronic
912663870 1:111561497-111561519 GTGTATGTATTGGGGGAAGGAGG + Intronic
912934312 1:113989464-113989486 TTTTATTTTTTGGGGGCAGGAGG + Intergenic
913650062 1:120905151-120905173 GTTTATTTCTTAGCAGAAGGAGG - Intergenic
914076614 1:144358350-144358372 GTTTATTTCTTAGCAGAAGGAGG + Intergenic
914102564 1:144608147-144608169 GTTTATTTCTTAGCAGAAGGAGG - Intergenic
914171062 1:145223935-145223957 GTTTATTTCTTAGCAGAAGGAGG + Intergenic
914296334 1:146329060-146329082 GTTTATTTCTTAGCAGAAGGAGG + Intergenic
914526175 1:148467903-148467925 GTTTATTTCTTAGCAGAAGGAGG + Intergenic
914640228 1:149599221-149599243 GTTTATTTCTTAGCAGAAGGAGG - Intergenic
915964834 1:160297506-160297528 GAGGGGTTCTTGGGGGAAGGAGG - Intronic
917013972 1:170508363-170508385 GTTTACTGCTTGTGGAAAGGAGG + Intergenic
917106210 1:171494778-171494800 GTTTCTTTCTTGAGGGAGGGGGG - Intronic
917179857 1:172284331-172284353 GTTTTGTTTTTAGGGGAAAGAGG + Intronic
921088124 1:211815676-211815698 GTTTAGTGGTTGAGGGAAGCTGG - Intronic
923220275 1:231886486-231886508 ATTTAGAGCCTGGGGGAAGGAGG - Intronic
923298227 1:232615735-232615757 GTTTAGTTCTGGGTGGAGGAAGG - Intergenic
923559403 1:235027419-235027441 GGAGAGTCCTTGGGGGAAGGAGG - Intergenic
924502950 1:244653465-244653487 GCCTAGTTCTCGGGGGAAGCCGG + Intronic
1063558564 10:7104383-7104405 GTCTACTTGATGGGGGAAGGTGG - Intergenic
1063752260 10:8963609-8963631 GTCTACTTGATGGGGGAAGGTGG + Intergenic
1064250109 10:13700418-13700440 CGTGAGTTCTTGGGAGAAGGTGG - Intronic
1065675180 10:28166350-28166372 GGTTATTTCTTGGAGGATGGAGG - Intronic
1065727898 10:28684051-28684073 GCTTAGTTTTTTGGGGCAGGTGG - Intergenic
1066332182 10:34436257-34436279 GTTTATTTGTTGGAGGAAAGGGG + Intronic
1066692426 10:38043594-38043616 GTGGAGTTGTTGGGGGGAGGTGG - Intronic
1067261700 10:44698674-44698696 GTCTATTTCTTGGGGGAATGTGG + Intergenic
1067501593 10:46809906-46809928 GTTTATCTCTTTGGGGATGGGGG - Intergenic
1067592981 10:47530003-47530025 GTTTATCTCTTTGGGGATGGGGG + Intronic
1067640096 10:48038106-48038128 GTTTATCTCTTTGGGGATGGGGG + Intergenic
1067902494 10:50256810-50256832 GTAAATTTCCTGGGGGAAGGAGG - Intergenic
1070073818 10:73115788-73115810 GTTTAGTTCTTGGGGGAAGGGGG - Intronic
1070137061 10:73704145-73704167 GTTTATCTCTTTGGGGATGGGGG + Intergenic
1070691617 10:78531391-78531413 GTTTCGTCCTGGGAGGAAGGTGG + Intergenic
1071965216 10:90845038-90845060 GTTGAGTTGCTGGGGGTAGGGGG + Intronic
1072669554 10:97419415-97419437 GTTTTGTGCTGGGTGGAAGGAGG - Intronic
1073861078 10:107741396-107741418 GTTTTGGAGTTGGGGGAAGGTGG + Intergenic
1075305401 10:121363379-121363401 GTGAAGGTCTTGGGGTAAGGGGG - Intergenic
1077541933 11:3150777-3150799 GTTTAGTTCTAGGGAGCAGGGGG - Intronic
1077917560 11:6621457-6621479 CTTTATTTATTGGGGGTAGGGGG - Exonic
1078480280 11:11669309-11669331 ATTTTGTTCCTGGGGGTAGGAGG - Intergenic
1078531402 11:12139406-12139428 GTTTAGTTGTGGGAGGAGGGAGG + Intronic
1079274518 11:19022058-19022080 GTTTTTTTCTTGGCGGTAGGGGG + Intergenic
1082861101 11:57857568-57857590 TTTTATTTGGTGGGGGAAGGAGG - Intergenic
1083193176 11:61067225-61067247 GCTTAGCTCTTGGTGGGAGGGGG + Intergenic
1084147674 11:67273655-67273677 GTTTCTTGCTTGGGGGGAGGGGG + Intronic
1084531849 11:69732136-69732158 GTTTTGTTTTTGGGGGGAGGTGG - Intergenic
1085926709 11:81032593-81032615 CTTTGGTGGTTGGGGGAAGGAGG + Intergenic
1086319490 11:85629618-85629640 TTTTTGTTTTTGGTGGAAGGTGG + Intronic
1088413059 11:109556865-109556887 GTTGCGGGCTTGGGGGAAGGAGG + Intergenic
1089926881 11:122268106-122268128 GTTTATTAGTTGGGGGATGGGGG - Intergenic
1090964040 11:131582784-131582806 GTTTTTTTGGTGGGGGAAGGGGG - Intronic
1091678096 12:2505973-2505995 GTTTAGGTACTGGGGGAAAGTGG - Intronic
1094390012 12:29938835-29938857 GATTAGTGCTTGGGAGAAAGGGG - Intergenic
1096499334 12:52055596-52055618 GTTTGGTTCTTGAGGGCTGGGGG + Intronic
1096972757 12:55681169-55681191 GTTTAGTTCTGTGGGGAATGGGG - Intergenic
1101448593 12:104756015-104756037 GCTTGGTTCCTGGGGCAAGGAGG + Intronic
1101756553 12:107625552-107625574 GTCTAGTTATTGGGGGTAGGTGG + Intronic
1102247584 12:111365063-111365085 ATATACTCCTTGGGGGAAGGTGG - Intronic
1102396285 12:112588999-112589021 GTGGGATTCTTGGGGGAAGGGGG + Intronic
1102647136 12:114411004-114411026 GTCTAGGTCTGGGGTGAAGGTGG + Intergenic
1103979460 12:124726970-124726992 GTTTAAGACTTGGGGGAAGCCGG - Intergenic
1107995631 13:45857601-45857623 GTTCAGTTGGTGGGGGATGGAGG - Intergenic
1109280246 13:60348082-60348104 GCTTTGTTGTTGGGGGAATGTGG + Intergenic
1109680563 13:65746806-65746828 GTTTATTTTTTGGGGGGTGGGGG - Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1111630005 13:90838417-90838439 GTTGAGGGCATGGGGGAAGGTGG - Intergenic
1112728757 13:102335484-102335506 TTTTATTTCTTGGTGGAATGGGG - Intronic
1113109195 13:106803522-106803544 GCCTAGTTATTGGGGGAAGTGGG + Intergenic
1113519584 13:110930173-110930195 GTGTAGTATTTGGGAGAAGGGGG - Intergenic
1115975597 14:38993085-38993107 TTTTAGTTCTTTGAGAAAGGAGG - Intergenic
1117253719 14:53957491-53957513 CTTTAGGCCTTGGGGGGAGGAGG - Intronic
1118440982 14:65811589-65811611 GTCTGGTTTTTTGGGGAAGGAGG - Intergenic
1118750677 14:68805991-68806013 GTTCAGTGCTTTGGGGAAGCTGG - Intergenic
1119476631 14:74934303-74934325 GTTTTATTCTAGGGGGAAGAAGG + Intergenic
1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG + Intronic
1121534428 14:94681596-94681618 GTTCAGTGCTTGGCAGAAGGAGG - Intergenic
1122714520 14:103687016-103687038 GTGTGGCTCTTGTGGGAAGGAGG + Intergenic
1202894886 14_GL000194v1_random:1331-1353 GTTTTGTTGATGGGGTAAGGAGG - Intergenic
1202882581 14_KI270722v1_random:74653-74675 GTCTAATTCTTGGGGGATCGGGG + Intergenic
1124635028 15:31359927-31359949 GTTGTGGTCTTGGGGGAGGGAGG + Intronic
1128654670 15:69451988-69452010 GCCTAGTGCTTGGGGGAAGGAGG - Intergenic
1129919013 15:79302573-79302595 GGGTAATTCTTGGGAGAAGGGGG + Intergenic
1130612649 15:85375659-85375681 TTTTATTTCTTGGGGGCAGAGGG - Intergenic
1131944208 15:97601267-97601289 TTTTAGTTCTTTGGAGAAGAGGG + Intergenic
1136648925 16:31648827-31648849 GTGGAGTTCATGGGGGAAAGTGG - Intergenic
1137282101 16:46986099-46986121 GTTTCTTTTTTGGGGGAATGGGG + Intergenic
1137712226 16:50574415-50574437 ATTTAGTCCCTGGGGGAAGACGG - Intronic
1140295725 16:73707854-73707876 GATTAATTCTTGGGAGACGGAGG + Intergenic
1141213362 16:82001547-82001569 GTTTTGTTTTTGGGAGAAGGGGG - Intronic
1142135799 16:88451581-88451603 GTGGACTTCTTTGGGGAAGGAGG + Intergenic
1143926882 17:10378952-10378974 ATTTAGATTTTGGGGGATGGTGG - Intergenic
1144356622 17:14452715-14452737 GTTGAGTTTTTGGGGGGAGGAGG - Intergenic
1144890479 17:18491364-18491386 GTTTAGTTCTTGGGGAAGGAGGG - Intronic
1145141738 17:20452954-20452976 GTTTAGTTCTTGGGGAAGGAGGG + Intronic
1145712941 17:26993274-26993296 GTCTTGTGGTTGGGGGAAGGTGG - Intergenic
1146262540 17:31431530-31431552 GTGCAGTCCCTGGGGGAAGGAGG + Intronic
1146922208 17:36721312-36721334 GTTTAGCTGTTGGGGTGAGGGGG - Intergenic
1152284586 17:79404708-79404730 GGATGGTTCTTGGGGGAGGGAGG - Intronic
1152859422 17:82686960-82686982 GTCCAGTGCTGGGGGGAAGGAGG + Intronic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1154132808 18:11751224-11751246 GTGTTGTACTTGGGGGAAGGAGG - Intronic
1154499956 18:14991235-14991257 GTTTCGTTGATGGGGTAAGGAGG - Intergenic
1156024537 18:32636815-32636837 CTTAGGTTCTTGGGGGAGGGAGG + Intergenic
1156530760 18:37812872-37812894 GTTAATTTTTGGGGGGAAGGAGG + Intergenic
1158654445 18:59317539-59317561 CTTTATTTTTTGGAGGAAGGTGG + Intronic
1159119759 18:64154937-64154959 ATTTATTTCTTGGAGGATGGTGG + Intergenic
1161441121 19:4292251-4292273 ATTAGGTTCTTGGGGGAAAGTGG + Exonic
1164432699 19:28201738-28201760 TTTGAGATCTTGGGGAAAGGAGG - Intergenic
1165170597 19:33889171-33889193 TTTTGGTTCTTGGCGGAGGGTGG + Intergenic
1166441176 19:42816586-42816608 ATTCAGTTCTTGGGTGGAGGAGG - Intronic
1166460656 19:42985193-42985215 ATTCAGTTCTTGGGTGGAGGAGG - Intronic
1166477947 19:43145166-43145188 ATTCAGTTCTTGGGTGGAGGAGG - Intronic
925397328 2:3544538-3544560 GATTACTTGTTGGGGCAAGGAGG + Intronic
928125178 2:28610700-28610722 GTGTAGTTCCATGGGGAAGGAGG - Intronic
929408025 2:41665622-41665644 GGTTAGTTATTGTGGGAGGGGGG - Intergenic
929537379 2:42792313-42792335 TCTTGGTTCTTGGGGGAAGATGG - Intronic
931684797 2:64784149-64784171 GTTCTGGTCTTAGGGGAAGGGGG + Intergenic
935571744 2:104669475-104669497 GTTTTTTTGGTGGGGGAAGGGGG + Intergenic
938050851 2:128169469-128169491 GTTTAGTTCTTCAGGAAATGTGG + Intronic
938719427 2:134052875-134052897 GTGAAGTTCTAGGGAGAAGGTGG - Intergenic
939758362 2:146141826-146141848 GTTAAGTTCTTGGAGTAAGGTGG + Intergenic
940200845 2:151148720-151148742 GTGGAGTTCTTTGGGGAAGCTGG - Intergenic
940344144 2:152612114-152612136 TTTTAGTTCTTAGGAGAAGGAGG + Intronic
940424509 2:153515091-153515113 GTTTGGATGTTGGGGGAGGGAGG + Intergenic
940833052 2:158489934-158489956 GTTTTGCTCACGGGGGAAGGGGG - Intronic
940854084 2:158716309-158716331 GTGTAGTTCTGAGGGGGAGGCGG - Intergenic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
945262626 2:207858959-207858981 GTCTAGGGCTTGGGGGAAGGAGG - Intronic
945503563 2:210609292-210609314 GATTAGGACTTGGTGGAAGGAGG - Intronic
946380530 2:219345639-219345661 GTTGAACTCTTGGGGGAAGTTGG + Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169321184 20:4634536-4634558 GTTTAGTTATTTGGGGAGGAGGG - Intergenic
1169801794 20:9518228-9518250 GGTAAGTTGTTGGGGGATGGAGG + Exonic
1172026315 20:31951418-31951440 GGGGAGTTCCTGGGGGAAGGAGG - Intronic
1174183944 20:48692430-48692452 GGTTACTTCTAGGGGGAAGAAGG + Intronic
1175017761 20:55810243-55810265 GTTTACTTCATGGAGGAAGGTGG - Intergenic
1176614587 21:9017318-9017340 GTTTTGTTGATGGGGTAAGGAGG - Intergenic
1177922798 21:27173774-27173796 GTTGATCTGTTGGGGGAAGGAGG + Intergenic
1177939520 21:27391433-27391455 GCTTGGTTCTATGGGGAAGGCGG - Intergenic
1179590185 21:42403024-42403046 GTTTACTTTCTGGGGGAGGGAGG + Intergenic
1181828012 22:25535444-25535466 GTTTTGTTCTGAGGGTAAGGGGG - Intergenic
1183111796 22:35655103-35655125 GTATAGTTCTTTGTTGAAGGTGG + Intronic
1183391479 22:37547687-37547709 GTTAATGTCATGGGGGAAGGTGG + Intergenic
950475864 3:13214481-13214503 ATTTGTTTCTTGGAGGAAGGAGG - Intergenic
954051859 3:47985943-47985965 GCCTAGTTCTTCGGGGAAAGAGG + Intronic
954728838 3:52639975-52639997 GTTTAGCTCTTGAGAGAAGAGGG + Intronic
956516699 3:70057207-70057229 ATTTTGTTATTGGGGAAAGGGGG + Intergenic
959589425 3:108061147-108061169 GATAAGTTTTTGGGGGGAGGGGG + Intronic
960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG + Intergenic
962498766 3:135967721-135967743 GTTTTCTTTTTGGGGGATGGGGG - Intronic
963950196 3:151190952-151190974 GTTTAGTTTCTGGGGGAGTGGGG - Intronic
964572784 3:158128423-158128445 GTGTCTTTCTTGGGGGAATGAGG + Intronic
966310611 3:178589438-178589460 GTTTTTTCCTTGGGGGGAGGGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969295299 4:6266713-6266735 GCTCAGCTCTTGGGGGAATGAGG + Intergenic
970001639 4:11370935-11370957 CTTTAGTTCTTGGGGGGGTGGGG + Intergenic
970217936 4:13778984-13779006 GTTGAGATCTTGGGGGCGGGGGG + Intergenic
971017069 4:22499112-22499134 GTTTACTTGTTCGGGGAAGGGGG - Intronic
975131705 4:70838800-70838822 ATTTAGCTGTTGGGGGGAGGGGG - Intronic
977809968 4:101347096-101347118 CTTTTATTCTTGGGGGAAGGGGG + Exonic
980892640 4:138831605-138831627 GTTTTGTGTTTGGGGGAAGGGGG + Intergenic
989981173 5:50647676-50647698 GTTTATTTCTTAGCAGAAGGAGG - Intergenic
992132490 5:73707122-73707144 CTTTACTTCTGGGGGCAAGGTGG - Intronic
992636274 5:78728601-78728623 GTTTAGTTCTGGGGGTGAGGTGG - Intronic
992937105 5:81719307-81719329 CTTTAGCTCTTGGAGGAAGCGGG - Intronic
993145629 5:84090157-84090179 TTTTAGTTCATGGAGGAATGTGG + Intronic
993804104 5:92383269-92383291 GTTCAGTTATTGGATGAAGGGGG + Intergenic
994369716 5:98954451-98954473 TTTTAGCTCTTGGTTGAAGGGGG - Intergenic
995136749 5:108687242-108687264 GTTTAGTTTTTGTGGAGAGGAGG + Intergenic
995137557 5:108696367-108696389 GTATGGTTCATGGGGGAGGGAGG - Intergenic
995945832 5:117644865-117644887 GTCCAGTTATTGGGGGCAGGTGG - Intergenic
996536982 5:124587547-124587569 GTTTAGTGATATGGGGAAGGGGG + Intergenic
997010361 5:129869858-129869880 GTTTTGTTGTTGGTGGTAGGTGG - Intergenic
998827852 5:146122651-146122673 GTTTTGTTCTTGGTGAAATGAGG - Intronic
999405102 5:151300048-151300070 CTTTTGTTCTTGGGTGGAGGGGG - Intronic
1000178881 5:158787682-158787704 GTTTCCTTATTGGGGAAAGGGGG + Intronic
1001301403 5:170536424-170536446 GGTCAGCTGTTGGGGGAAGGTGG - Intronic
1001823662 5:174728882-174728904 GTGTGTTTCTTGGGGGGAGGGGG - Intronic
1002496559 5:179617381-179617403 GATTAATTCTTGGGGGATGCGGG - Intronic
1002940133 6:1708577-1708599 GTTTAGATCTTGGGAAAAGCAGG + Intronic
1004467794 6:15902090-15902112 TTTTAGTTCTTGGAGAAATGGGG - Intergenic
1004995389 6:21186311-21186333 GCTGAGTTCTTTGGGGAATGGGG + Intronic
1005845946 6:29778762-29778784 GTTGAATAATTGGGGGAAGGTGG - Intergenic
1005956844 6:30670197-30670219 CTTAAGTTGTAGGGGGAAGGAGG - Intronic
1006082713 6:31576669-31576691 GTTTTGGTCTTGGGGGAGGATGG + Intronic
1007705823 6:43790571-43790593 TTTCAGTTCTTGTGGGAGGGAGG - Intergenic
1007726230 6:43917433-43917455 TTATAGTCCCTGGGGGAAGGAGG + Intergenic
1010184631 6:73128905-73128927 GGTTGGCTTTTGGGGGAAGGGGG + Intronic
1011569649 6:88721379-88721401 GGTTAGTTGTGGGGGCAAGGAGG - Intronic
1011948867 6:92939299-92939321 GTTCACTTGTTGGGGGAAGGGGG - Intergenic
1015536680 6:134273774-134273796 GTTTAGGTCATGGGGCAATGAGG + Intronic
1015706928 6:136098123-136098145 CTTTAGTTCCTGGGGGGGGGGGG + Intronic
1016315385 6:142779979-142780001 GTTTAATTTTTAGGAGAAGGAGG + Intronic
1017901041 6:158718720-158718742 GGTTAGTCCTGGTGGGAAGGTGG - Intronic
1018373040 6:163186199-163186221 GCTCCATTCTTGGGGGAAGGGGG - Intronic
1018439141 6:163793052-163793074 GTTTTGTTCTACAGGGAAGGAGG - Intergenic
1019593981 7:1849974-1849996 GTTTCTTCCTTGGAGGAAGGTGG - Intronic
1021055897 7:16045787-16045809 TTTTGGTTTTTGGGGGAAGGTGG - Intergenic
1022060242 7:26786025-26786047 GTTCAGTTCTTGGGGTGAAGGGG - Intronic
1022170371 7:27822321-27822343 TTTTACTTCTTTGGGGAAAGTGG + Intronic
1022489188 7:30803685-30803707 GTTTTGTTTTTGGGGTAGGGGGG + Intronic
1023517998 7:41021615-41021637 CTCTAGTTCTTGGGGGTGGGGGG - Intergenic
1024526656 7:50355050-50355072 GCCTGGGTCTTGGGGGAAGGTGG + Intronic
1024897707 7:54279645-54279667 GTTTTGTTATTGGGGTAATGAGG + Intergenic
1025999777 7:66551791-66551813 GATCAGCTCTTGGTGGAAGGAGG - Intergenic
1029402606 7:100355302-100355324 GGATAGTTGTTGGGGGAAGGTGG + Intronic
1032608699 7:133387870-133387892 GTTGAGTTCATGGGCAAAGGGGG + Intronic
1032629034 7:133626546-133626568 GTTTAGGTGTTGGGGTAGGGAGG + Intronic
1035520153 8:269359-269381 CTTTTTTTCTTGGGGGAGGGTGG - Intergenic
1037246351 8:16840033-16840055 GGTTAGTTCTTGGTTGAAGTTGG + Intergenic
1037533078 8:19797476-19797498 GGTTACTTGTTGGGGGAAGGAGG + Intergenic
1038071169 8:24015057-24015079 GTTTGAGTCTTGGGGGAAGGGGG + Intergenic
1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG + Intronic
1040096650 8:43451597-43451619 TTTTAGTTCTTGGATGGAGGAGG - Intergenic
1043415890 8:80048582-80048604 GGGTAGTTCTTGAGGGAACGTGG + Intronic
1044171666 8:89060497-89060519 GTTTAGTTTATTGGGGAAGAGGG - Intergenic
1047136774 8:122088179-122088201 GGTTGGTTCTTGGGCCAAGGAGG - Intergenic
1047460776 8:125063155-125063177 GTTTAGTGATTTGGGGAAAGGGG - Intronic
1048288895 8:133164608-133164630 GTTTAGTTCTAGGTAGAATGGGG - Intergenic
1048615846 8:136074807-136074829 TTTTATTTCATGGGGGAGGGAGG + Intergenic
1049034043 8:140060704-140060726 GTTTATTTCTGGGGGGAGGAAGG + Intronic
1049989906 9:981083-981105 GTTTATTTCTTAGGGGGTGGGGG + Intronic
1052434852 9:28413392-28413414 GTTTATTTTATGGGGAAAGGAGG - Intronic
1052973615 9:34396587-34396609 GTTTAGTCCTTGGGTGAGAGAGG - Intronic
1055983092 9:82025559-82025581 GCTTAGCTCTGGGGGTAAGGGGG - Intergenic
1056697539 9:88872505-88872527 TTTTATTTTTTGAGGGAAGGGGG + Intergenic
1058809718 9:108627713-108627735 GCTTGATGCTTGGGGGAAGGAGG - Intergenic
1058887118 9:109329988-109330010 GTTTAGGTGTGGGTGGAAGGAGG + Intergenic
1060736473 9:126069601-126069623 CTTCATTTCCTGGGGGAAGGGGG + Intergenic
1061643565 9:131980068-131980090 TGTTATTTCTTGGGGGATGGGGG + Intronic
1061832794 9:133306407-133306429 GTTTTGTCCTGGGGGGAAGCCGG - Intergenic
1061960453 9:133986156-133986178 GTTTAGTTACTTGGTGAAGGTGG - Intronic
1062208883 9:135352493-135352515 GTTCAGTTCTTGGAGGACAGGGG - Intergenic
1186706004 X:12139414-12139436 ATTTAGGAGTTGGGGGAAGGCGG - Intronic
1187747476 X:22425372-22425394 GTTTAGTCCCTGCTGGAAGGTGG - Intergenic
1187799525 X:23045172-23045194 GTTTAGTTCTTGGGGTCAGGCGG - Intergenic
1187967788 X:24630182-24630204 CTCAAGTTCTTTGGGGAAGGAGG - Intronic
1188648830 X:32604470-32604492 TTGTAGTTCTTGGGGGAGGGGGG - Intronic
1189222213 X:39382211-39382233 GATTAGATCTTGGAGGGAGGAGG + Intergenic
1189828742 X:44948407-44948429 TTTTAGTTCATGAGAGAAGGGGG + Intronic
1189945998 X:46179840-46179862 GTTTAGCTCTCAGGGGAAGGGGG - Intergenic
1190228274 X:48562151-48562173 GGTTAGTACTTGGGAGAAGCTGG - Exonic
1190279494 X:48919720-48919742 GGGTGGTTCTTGGGGGATGGGGG + Intergenic
1192432108 X:71119324-71119346 GTTTTTTCCTTAGGGGAAGGGGG - Intronic
1194478768 X:94393868-94393890 GGGTAGTGATTGGGGGAAGGTGG - Intergenic
1195969990 X:110462722-110462744 TTTTAGGTTTTGGTGGAAGGAGG - Intergenic
1198016859 X:132620291-132620313 GTTTCATTCATGGGGGGAGGGGG + Intergenic
1198280234 X:135134311-135134333 GTCCAGTTCTTGAGGCAAGGAGG + Intergenic
1198290724 X:135238203-135238225 GTCCAGTTCTTGAGGCAAGGAGG - Intergenic
1198997180 X:142586476-142586498 GTATATTTCTTGGGGGGTGGGGG + Intergenic