ID: 1070084361

View in Genome Browser
Species Human (GRCh38)
Location 10:73221610-73221632
Sequence ACATGGGGAAAACTACATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070084361_1070084362 -10 Left 1070084361 10:73221610-73221632 CCTTAATGTAGTTTTCCCCATGT 0: 1
1: 0
2: 2
3: 21
4: 218
Right 1070084362 10:73221623-73221645 TTCCCCATGTTTCTTCTGCCTGG No data
1070084361_1070084367 18 Left 1070084361 10:73221610-73221632 CCTTAATGTAGTTTTCCCCATGT 0: 1
1: 0
2: 2
3: 21
4: 218
Right 1070084367 10:73221651-73221673 GTTTAACTTCATAGATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070084361 Original CRISPR ACATGGGGAAAACTACATTA AGG (reversed) Intronic
900744937 1:4354617-4354639 ACATGGGGACGCCTACATTCTGG + Intergenic
903075260 1:20759748-20759770 TTATGGGGAAAAATACATTCAGG + Intronic
904450734 1:30609704-30609726 CCATGGGGAAAACTACTGTTGGG + Intergenic
904572422 1:31476997-31477019 AAAGGGGGAGTACTACATTAAGG - Intergenic
905228717 1:36497546-36497568 AAATGGGTAAAACTATATTTTGG - Intergenic
905952153 1:41960907-41960929 ACATTGTGAAAAGTACATGAGGG - Intronic
906840053 1:49127588-49127610 ACAAGGGTAAAACTCCATGAGGG + Intronic
908581083 1:65517995-65518017 AATTGGAGAAAACTACATTTAGG - Intronic
909307911 1:74105211-74105233 AGATGTGAAAAAATACATTAAGG - Intronic
910246929 1:85148974-85148996 ACTTGGGGAACAGTAAATTAGGG - Intergenic
910516391 1:88065843-88065865 ACGAGGGGGAAACAACATTAGGG - Intergenic
911814211 1:102323195-102323217 TCATGAGGAAAACTACAAAAAGG + Intergenic
911826615 1:102494742-102494764 ACATAAGGGAAACTACAATAAGG + Intergenic
912201904 1:107467917-107467939 AGGTGAGGAAAACAACATTATGG - Intronic
912271898 1:108219880-108219902 ACATGAAGAAAACTACACCAAGG - Intergenic
912296935 1:108478646-108478668 ACATGAAGAAAACTACACCAAGG + Intergenic
912596736 1:110886325-110886347 ACATGAAGAAAGCTACACTAAGG - Intronic
912936219 1:114005637-114005659 AGATGGAGAAAACTACAACATGG - Intergenic
913970865 1:143415679-143415701 ACATGAAGAAAATTACACTAAGG - Intergenic
914065242 1:144241290-144241312 ACATGAAGAAAATTACACTAAGG - Intergenic
914113909 1:144725064-144725086 ACATGAAGAAAATTACACTAAGG + Intergenic
914378718 1:147097139-147097161 ACATGAAGAAAACTACACTAAGG - Intergenic
914765633 1:150635475-150635497 AGATGGGGAAAACCGCCTTAGGG + Intergenic
915727955 1:158032195-158032217 CCATGGGGGAAACTAGATCAGGG + Intronic
917412865 1:174778084-174778106 ATATGAAGAAAACTACATCAAGG + Intronic
923170159 1:231408523-231408545 ACATGGAGAAAAATGAATTAAGG + Intronic
924019015 1:239760836-239760858 ACATGAGGAAAACGACACCAAGG - Intronic
1063262922 10:4410472-4410494 ACATGAGGAAGAGTTCATTAAGG - Intergenic
1063811937 10:9721515-9721537 GCATGGAGAAAACTACACCAAGG + Intergenic
1064324516 10:14336874-14336896 ACATGAAGAAAACTACACCAAGG + Intronic
1066630172 10:37451679-37451701 ACATGAAGAAAACTACACCAAGG - Intergenic
1066826823 10:39606191-39606213 AATTGGGAAAAACTACTTTAAGG - Intergenic
1067826801 10:49580345-49580367 ACATGAAGAAAACTACACCAAGG + Intergenic
1070013734 10:72503283-72503305 ACATGAAGAAAACTGCATCAAGG + Intronic
1070084361 10:73221610-73221632 ACATGGGGAAAACTACATTAAGG - Intronic
1071432976 10:85620610-85620632 GCATGAGGAAAAATCCATTAGGG + Intronic
1071593971 10:86904270-86904292 ACATGAAGAAAACTACATTAAGG + Intronic
1072096848 10:92190326-92190348 ACATGGGGAACACTATTTTGAGG - Intronic
1072887987 10:99297197-99297219 ACATGAGGCAGACTGCATTATGG - Intergenic
1074439140 10:113459691-113459713 ATAATGAGAAAACTACATTATGG - Intergenic
1076565108 10:131393313-131393335 AAATGGGGAGAATTGCATTAGGG - Intergenic
1077662002 11:4078135-4078157 AAAGGGGGAAAACTACCTGATGG - Intronic
1077786209 11:5386410-5386432 ACAAGGAGAAAACTACAAAAAGG - Intronic
1078784094 11:14470813-14470835 ACATGAAGAAAACCACACTAAGG + Intronic
1079806471 11:24936924-24936946 AGATGTGTAAAACTTCATTAAGG + Intronic
1081219831 11:40446887-40446909 ACATGGGGATAATGAGATTATGG + Intronic
1081247503 11:40787083-40787105 ACATGGGGAGAACTACTATGTGG - Intronic
1085943175 11:81230656-81230678 CCATGGGGAAATCTCCAATATGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094766718 12:33604450-33604472 ACATGAAGAAAACTACATCCAGG + Intergenic
1095607263 12:44084213-44084235 ACAAGGGGAATACTAAATTTGGG + Intronic
1095866833 12:46981671-46981693 ACATGAAGAAAACTACACCAAGG + Intergenic
1095877857 12:47101606-47101628 ATATGGGGAAAACTATAATATGG + Intronic
1096000807 12:48128430-48128452 ACATGTGGAGAATTACAATATGG - Intronic
1098118467 12:67207257-67207279 ATATGTGGAAAAATACATTCTGG - Intergenic
1098654337 12:73009111-73009133 AGATGGGGAAAACTGCCTTAGGG - Intergenic
1105586243 13:21746207-21746229 AAATGAGGAAAACTACACCAAGG - Intergenic
1106051378 13:26193031-26193053 AAATGGGGAAAACTGGGTTAGGG + Intronic
1106276458 13:28212982-28213004 ACATGAAGAAAATTACATCAAGG + Intronic
1106362397 13:29044405-29044427 ACATGAAGAAAACAACATCAAGG - Intronic
1106772603 13:32976275-32976297 TCATGTAGAAAACTACATTATGG - Intergenic
1107700329 13:43040922-43040944 AGATGGGGAAAACTGCCTTAGGG - Intronic
1108864308 13:54904396-54904418 ATATGGGGAAAATTCCAGTAAGG - Intergenic
1108900534 13:55401005-55401027 ACATAGGGAAAACCACAAAAAGG - Intergenic
1111600126 13:90462084-90462106 ACATGGAGAGACCCACATTAAGG - Intergenic
1112163280 13:96890947-96890969 ACATGAAGAAAATTACATCAGGG - Intergenic
1115760241 14:36573488-36573510 ACAAGGTGAAAACTAGACTATGG - Intergenic
1116870694 14:50066935-50066957 AAATGGGGGAAAATACATTTAGG + Intergenic
1117813569 14:59574725-59574747 CCATGAAGAAAACTAAATTATGG - Intronic
1120245403 14:81999985-82000007 ACATGGGCAAAGCTACAATAAGG - Intergenic
1120658817 14:87228812-87228834 AAATAAGGAAAACTACATTATGG + Intergenic
1126260017 15:46678338-46678360 ACACGGAGAAAAATACCTTAGGG + Intergenic
1127251188 15:57240034-57240056 CTCTGGGGAAACCTACATTAAGG + Intronic
1129660823 15:77551976-77551998 ACCAGGGGAAAACTGCATTGCGG + Intergenic
1131633709 15:94207333-94207355 CCATGGGGGAAACTAGATGAAGG + Intergenic
1133411261 16:5571112-5571134 ACATGGGTAGAATTACATGAAGG - Intergenic
1134194181 16:12146216-12146238 ACTTGGGGAAATACACATTAAGG - Intronic
1134321142 16:13165053-13165075 ACATGGAGAAAACTATACCAAGG - Intronic
1135119779 16:19755801-19755823 ACATGGTCAAACCTCCATTAGGG - Intronic
1136653877 16:31697327-31697349 TCATGTGGAAAACTGCAATATGG - Intergenic
1136910901 16:34143145-34143167 ACAAGAGGGAAACTACATAAAGG + Intergenic
1138737410 16:59266302-59266324 AAATGGGAAAAACCACATCAAGG + Intergenic
1140604421 16:76517344-76517366 TCATGGGGGAAACTAGATAAAGG + Intronic
1140653033 16:77109073-77109095 ACGTGGGGAATACCACATGAAGG - Intergenic
1140713124 16:77696449-77696471 CCTTGGGGAAAACAAGATTATGG + Intergenic
1141025832 16:80546526-80546548 AAATTGGGAAGACTACTTTACGG - Intronic
1143086851 17:4422558-4422580 GCAGGGGGAACAATACATTAGGG - Intergenic
1144415412 17:15041881-15041903 ATATGTGGAAAAATACAATATGG + Intergenic
1146410842 17:32583337-32583359 TCATGAAGAAAACTACACTAAGG - Intronic
1148333873 17:46828656-46828678 ACCTGGGCAGAACTACATTCTGG - Intronic
1148996962 17:51719081-51719103 ATGTGTGCAAAACTACATTACGG + Intronic
1150664179 17:67115482-67115504 ACAGGAAGAAAACTACATCAAGG + Intronic
1153395207 18:4612039-4612061 ATATGGGGAGAACTCCAATATGG - Intergenic
1153548331 18:6233801-6233823 AATTGGGAAAAACTACTTTAAGG + Intronic
1153770467 18:8411590-8411612 ACATGAAGAAAACTATACTAAGG + Intergenic
1156104856 18:33647838-33647860 ATATGGGGCAAAATACATAAGGG + Intronic
1158793103 18:60806101-60806123 ACATGGGGAAAAGTATATGATGG - Intergenic
1158862718 18:61608363-61608385 ACAGGGGGAAAACTAGACTCTGG + Intergenic
1165476048 19:36031798-36031820 AAATGTGAAAAATTACATTATGG + Intronic
1168276378 19:55280735-55280757 ACATGGGGAAGAGTCCATGAGGG - Intergenic
927298398 2:21481924-21481946 AGATGGGGAAAACTGCTTGATGG + Intergenic
928604283 2:32930003-32930025 TAATGGGAAAAGCTACATTAAGG - Intergenic
929211452 2:39361305-39361327 ACATGGGGAAAAATAGAGTAAGG - Intronic
930485349 2:52005119-52005141 ATCTGGGGAAAACTACAGGAAGG + Intergenic
930923019 2:56780546-56780568 ACATGAAGAAAACTATACTAAGG + Intergenic
932789030 2:74636918-74636940 ACATGAAGAAAACTACATTAAGG - Intronic
934175566 2:89576605-89576627 ACATGAAGAAAATTACACTAAGG - Intergenic
934285882 2:91650969-91650991 ACATGAAGAAAATTACACTAAGG - Intergenic
935895273 2:107730321-107730343 CATTGGGGAAAACTACATAAAGG + Intergenic
936025673 2:109029375-109029397 AAATGGGAGAAACTTCATTAGGG + Intergenic
937154383 2:119708447-119708469 ACATGAGCAAAACTTCCTTATGG + Intergenic
939806649 2:146782082-146782104 ACAGGAGGAAAACTACACCAAGG - Intergenic
940427484 2:153546738-153546760 ACATGCTGAAAATTACATTGTGG - Intergenic
940705750 2:157102805-157102827 ACATGAAGAAAACTACACCAAGG - Intergenic
941723588 2:168837684-168837706 AGATGGGGAAAGCTTGATTAGGG - Intronic
942265843 2:174224772-174224794 ACAAGGGGAAGACAACCTTATGG + Intronic
943257481 2:185614377-185614399 ACATAGAAAAAACTTCATTATGG - Intergenic
943269391 2:185778875-185778897 AAATGGGCAGAGCTACATTAAGG - Intronic
943674471 2:190703592-190703614 ACATTCTGAAAACTTCATTAGGG + Intergenic
944057582 2:195539301-195539323 ACATGAAGAAAACTACACTAAGG + Intergenic
945497058 2:210521390-210521412 ACATGAAGAAAACTACACCAAGG - Intronic
1169186853 20:3625464-3625486 ACATGGCAAATACTACATTTAGG - Intronic
1169428615 20:5515693-5515715 AATTGGGAAAAACTACTTTAAGG - Intergenic
1171451924 20:25241811-25241833 AGATGGGGTAAACTGCCTTAGGG + Intergenic
1171812990 20:29760899-29760921 ACAAGAGGGAAACTACATAAAGG - Intergenic
1171906246 20:30901418-30901440 ACAAGAGGGAAACTACATAAAGG + Intergenic
1173104095 20:40115652-40115674 AGATGGGAAAAATTACAATACGG + Intergenic
1176918375 21:14654520-14654542 ACATGAGGCAAACTCCATGATGG + Intronic
1177608360 21:23412084-23412106 AAATGGGGAAAACTGTATTCTGG + Intergenic
1178936900 21:36870690-36870712 ACATGAGGAAAAATATCTTAAGG + Intronic
1180339666 22:11607535-11607557 ACAAGAGGGAAACTACATAAAGG + Intergenic
1181594870 22:23907646-23907668 AGATGGGGAAAACCGCCTTAGGG + Intergenic
949286190 3:2407851-2407873 ACATAGGGAATATTACATGAAGG - Intronic
949949328 3:9216276-9216298 ACAAGGGGAATACAAAATTATGG + Intronic
955069139 3:55557642-55557664 ACATGGGCAAAAATCCATTTGGG + Intronic
956443066 3:69298820-69298842 TTATGGAGAAAACTCCATTAGGG - Intronic
957321041 3:78630537-78630559 AAAGGGGGAAAACTCCTTTAAGG - Intronic
958489385 3:94752432-94752454 ACAGGGGTAAAACGACATTCAGG - Intergenic
958888760 3:99759470-99759492 AAAAAGGGAAAACTACATAAGGG + Intronic
960101669 3:113748254-113748276 ACATTGGTAATAATACATTATGG - Intronic
961618453 3:128203692-128203714 ACATGAGGATATCTACATTTTGG + Intronic
962960134 3:140303615-140303637 ACTTGGGGAAAAGGAGATTATGG + Intronic
963795084 3:149623879-149623901 ACATTGCCAAAACTACATGAAGG - Intronic
968263804 3:197346634-197346656 AAATGGGAAAAAGCACATTAAGG - Intergenic
972198616 4:36685085-36685107 ACAAGGAGAAAACTGCATGAAGG - Intergenic
973595747 4:52487283-52487305 ACATGAAGAAAACTACACAAAGG + Intergenic
973617092 4:52690042-52690064 ATAAGGGGAAAAATACATAAGGG + Intergenic
974393819 4:61309278-61309300 ACAGGGGGAGAACCAAATTAGGG - Intronic
975238404 4:72028424-72028446 CCTTGGGGAATATTACATTAAGG - Intergenic
975491375 4:74992515-74992537 ACATGAAGAAAACTGCATCAAGG + Intronic
975867244 4:78736673-78736695 AAAAGGGGAAAAGCACATTAGGG + Intergenic
976165443 4:82249592-82249614 TCATAGGGAAAAGAACATTAAGG + Intergenic
976269173 4:83213630-83213652 ATATGGAGAAAAATACAATAGGG + Intergenic
978199894 4:106013372-106013394 ACATAAAGAAAACTACACTAAGG - Intergenic
979161355 4:117465389-117465411 ACAGGAGGAAAACTATAGTAAGG + Intergenic
980331477 4:131415957-131415979 ACATGGGGGAAGCTGCAGTATGG - Intergenic
980871791 4:138620376-138620398 ACATGGAAAAAATTACATTGTGG + Intergenic
984352804 4:178617490-178617512 ACATAGTGAAAACTACAATATGG + Intergenic
986751897 5:10794873-10794895 AGCTGGGGAAGACTACATGAGGG + Intergenic
987648227 5:20704394-20704416 ACATTTGGAAAATTATATTATGG - Intergenic
988748101 5:34164504-34164526 ACATTTGGAAAATTATATTATGG + Intergenic
991640652 5:68748508-68748530 ACATGGGGAAAATAACAGGAGGG - Intergenic
993308643 5:86300121-86300143 ACATGAAGAAAACTACACCAAGG + Intergenic
993428960 5:87806591-87806613 ACATGAAGAAAACTACACCAAGG + Intergenic
994998607 5:107098502-107098524 CCATGAAGAAAACTAAATTAAGG - Intergenic
998747700 5:145279881-145279903 TCATGGTGAAAACTTCATCATGG + Intergenic
999487667 5:152015274-152015296 ACATTAAGAAAACTACACTAAGG - Intergenic
1000541426 5:162545197-162545219 ACATGGAGAAAAATATAATAAGG + Intergenic
1001920779 5:175597698-175597720 ACATGGCAAATACTACATGATGG + Intergenic
1002145932 5:177181393-177181415 CCATGTGGGAAACTTCATTATGG + Intronic
1002350566 5:178580580-178580602 ACATGATGAAAACTGCATAAGGG + Intronic
1002355808 5:178627658-178627680 AAATGGGGAAAACTTCGTTAGGG - Intronic
1002705642 5:181159748-181159770 ACATGGGGATAATAACAGTATGG + Intergenic
1002795416 6:467507-467529 ACATTGGGGAAACTAGATGAAGG - Intergenic
1002978466 6:2110202-2110224 ACATTGGGAGAATTGCATTATGG - Intronic
1003564515 6:7211810-7211832 ACTTGGGCACAACAACATTAGGG + Intronic
1004227192 6:13796819-13796841 ACCTGGGAAAAACTACATCAAGG - Intronic
1005545679 6:26867607-26867629 ACATTTGGAAAATTATATTATGG + Intergenic
1007021141 6:38522810-38522832 ACAGAGGGAAAACTAGAATAGGG - Intronic
1007793498 6:44328426-44328448 AGATGGGAAAAACCACCTTAGGG - Intronic
1007865476 6:44964575-44964597 ACATGTGAAAGACTAAATTATGG + Intronic
1008151667 6:47959583-47959605 ACATGATGAAAACTACAGTGAGG + Intronic
1009016390 6:57908369-57908391 ACATTTGGAAAATTATATTATGG + Intergenic
1009399876 6:63242022-63242044 ACATAAATAAAACTACATTAAGG + Intergenic
1011707502 6:90016992-90017014 ACATGAGGAAAACTACACAAAGG - Intronic
1012051583 6:94351810-94351832 AAATGTGGAAAACGAAATTATGG + Intergenic
1012337151 6:98074537-98074559 ACATGAAGAAAACTACACCAAGG + Intergenic
1012898573 6:104980163-104980185 AATTTAGGAAAACTACATTACGG - Intronic
1013386000 6:109631737-109631759 AAATGTGGATAAATACATTATGG + Intronic
1015375473 6:132505009-132505031 ACAAGGGGAAAACAACATAAAGG + Intronic
1015553712 6:134439187-134439209 AAATGGGGAAAAGTAAACTAAGG + Intergenic
1016430504 6:143980177-143980199 ACATGAAGAAAACTACACCAAGG - Intronic
1016851089 6:148619693-148619715 TCATGTGGAAACCTACCTTATGG - Intergenic
1017807537 6:157958678-157958700 GCATGGAGAAAACTATATTAAGG - Intergenic
1018200400 6:161389203-161389225 ACATGGTGAAGACAACATGAAGG - Intronic
1018386369 6:163307669-163307691 AAATGGGGAAACACACATTATGG + Intronic
1020207879 7:6133030-6133052 ACATGAAGAAAACTACACAAAGG - Intronic
1020400932 7:7776477-7776499 CCATGGGGAAAACTAGGTGACGG + Intronic
1021277906 7:18678296-18678318 ACACAGAGAAAACCACATTAAGG - Intronic
1021360126 7:19702352-19702374 ACAACGGGAAAGCTACATGAAGG + Intronic
1021463898 7:20920172-20920194 ACATGGGGAAAAATAATTCAGGG + Intergenic
1022025400 7:26443682-26443704 AGAAGGGCACAACTACATTATGG + Intergenic
1022588544 7:31639097-31639119 ACATGAAGAAAACTACACCAAGG - Intronic
1023339397 7:39203827-39203849 AGATGGGGAAAGCCATATTAGGG + Intronic
1023339404 7:39203860-39203882 AGATGGGGAAAGCCATATTAGGG + Intronic
1025071733 7:55905522-55905544 ACTTTGGGAAAACTACAATTAGG + Intronic
1026079275 7:67202889-67202911 CACTGGGGAAAACTACATGAAGG - Intronic
1031041325 7:116841432-116841454 ACATAGGTAAAACTAATTTACGG + Intronic
1031120388 7:117715270-117715292 ACATGTGAAAAGCTACATGAAGG + Intronic
1031636079 7:124102733-124102755 AAATGGAGAAGGCTACATTAAGG + Intergenic
1033563407 7:142555697-142555719 ACATGCTGACAACTACATAAGGG - Intergenic
1033758179 7:144413847-144413869 ACATACAGAAAACTACACTAAGG - Intergenic
1034604434 7:152298326-152298348 ACATGAAGAAAATTACATTAAGG + Intronic
1035626891 8:1077138-1077160 ACATGGAGAACACTGCATGAAGG - Intergenic
1038365533 8:26928607-26928629 GCATAGAGAAAACTACAGTAAGG + Intergenic
1039794373 8:40899690-40899712 ATATGGTGACAAATACATTAAGG - Intergenic
1040597032 8:48848290-48848312 ACATGTAGAAAACTAAATAATGG - Intergenic
1041271035 8:56109678-56109700 ACATAGGGAAAACTGAATAAAGG - Intergenic
1042697824 8:71577136-71577158 ACATGAAGAATACTACATCAAGG - Intronic
1044084883 8:87932314-87932336 ACATGGGTAAAACAACACCAAGG + Intergenic
1044630716 8:94275916-94275938 AGCTAGGGAAAACTTCATTAGGG + Intergenic
1045434157 8:102143449-102143471 ACCTGAGGAAAACTACACGATGG - Intergenic
1045827417 8:106415172-106415194 AAATGGTGAAAAGTAAATTATGG - Intronic
1047662121 8:127048590-127048612 ACATGGGGAAATCTGAATGATGG - Intergenic
1048242741 8:132760040-132760062 ACTTGGGGAACACTAAAATAAGG - Intronic
1050760622 9:9065616-9065638 CCATGGGAGAAAATACATTATGG + Intronic
1051608557 9:18939982-18940004 ACATGGGGAAAACAGGATTAGGG + Intronic
1051877933 9:21810655-21810677 ACATGAGGTATACTGCATTAGGG + Intronic
1055860098 9:80739226-80739248 ACATGAGAAAAACTACACCAGGG + Intergenic
1056647125 9:88423401-88423423 AATTGGGAAATACTACATTATGG + Intronic
1058624399 9:106919480-106919502 AAATGGGGAAAAGTAAATTATGG - Intronic
1059605997 9:115836630-115836652 ACACGAGGAAAACTACAACAAGG + Intergenic
1060819768 9:126654613-126654635 ACATGGGGAAGGCTCCATTCTGG - Intronic
1203363962 Un_KI270442v1:241891-241913 ACAAGAGGGAAACTACATAAAGG - Intergenic
1189151190 X:38708446-38708468 AAATGAAGAAAATTACATTAAGG + Intergenic
1189807256 X:44748302-44748324 TCATGGGGGAAAATGCATTAGGG + Intergenic
1192626466 X:72733747-72733769 AGATGGGGAAAACTGCCTTAGGG + Intergenic
1193678463 X:84485911-84485933 ACATAGGGTAAAATACAATATGG - Intronic
1197076839 X:122363553-122363575 GCTTGGGGAAAACTGCAGTATGG + Intergenic
1198777272 X:140193457-140193479 ACATGGGGCAAACTGAATTTGGG - Intergenic
1199485562 X:148344012-148344034 ACATTAGGGAAAATACATTAGGG + Intergenic
1201388255 Y:13467287-13467309 ACATTGGGCAAAATACATTAAGG - Intronic