ID: 1070089248

View in Genome Browser
Species Human (GRCh38)
Location 10:73268767-73268789
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070089248_1070089260 18 Left 1070089248 10:73268767-73268789 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1070089260 10:73268808-73268830 CCCAACCCTCGAAAGTAGCTGGG No data
1070089248_1070089264 26 Left 1070089248 10:73268767-73268789 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1070089264 10:73268816-73268838 TCGAAAGTAGCTGGGACCACAGG No data
1070089248_1070089258 17 Left 1070089248 10:73268767-73268789 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1070089258 10:73268807-73268829 CCCCAACCCTCGAAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070089248 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr