ID: 1070094102

View in Genome Browser
Species Human (GRCh38)
Location 10:73319588-73319610
Sequence TCATTGCCTGCAAGCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070094097_1070094102 21 Left 1070094097 10:73319544-73319566 CCTGTAGCTTCTGCTTTCCTGAA 0: 6
1: 58
2: 74
3: 111
4: 389
Right 1070094102 10:73319588-73319610 TCATTGCCTGCAAGCCATCAGGG No data
1070094099_1070094102 -7 Left 1070094099 10:73319572-73319594 CCTCTGCCTTTAAAAATCATTGC 0: 1
1: 7
2: 16
3: 78
4: 354
Right 1070094102 10:73319588-73319610 TCATTGCCTGCAAGCCATCAGGG No data
1070094098_1070094102 4 Left 1070094098 10:73319561-73319583 CCTGAAATTTACCTCTGCCTTTA 0: 7
1: 33
2: 52
3: 102
4: 323
Right 1070094102 10:73319588-73319610 TCATTGCCTGCAAGCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070094102 Original CRISPR TCATTGCCTGCAAGCCATCA GGG Intronic
No off target data available for this crispr