ID: 1070096761

View in Genome Browser
Species Human (GRCh38)
Location 10:73345028-73345050
Sequence TTTGAATCTCTATAAATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 353}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070096760_1070096761 -4 Left 1070096760 10:73345009-73345031 CCATATGAGTACAGACATGTTTG 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1070096761 10:73345028-73345050 TTTGAATCTCTATAAATATCTGG 0: 1
1: 0
2: 2
3: 49
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070096761 Original CRISPR TTTGAATCTCTATAAATATC TGG Intronic
906997489 1:50812555-50812577 TTTAAATCTCTAAAAATAAAAGG + Intronic
909224701 1:73004351-73004373 GTTATATCTGTATAAATATCAGG + Intergenic
909756768 1:79236118-79236140 TCTGATTCTTAATAAATATCTGG - Intergenic
909964171 1:81886991-81887013 TTTTAATATCTCTAGATATCGGG - Intronic
910510980 1:88003598-88003620 TTTGAGTCTCTAAAAATGTTAGG + Intergenic
910657962 1:89637462-89637484 TATGACTCACTATAAATATGAGG + Intronic
910972697 1:92872498-92872520 TTTGAATAACTCTTAATATCTGG + Intronic
912100401 1:106196675-106196697 TTTTACTCTCTATGAATATGAGG - Intergenic
912397916 1:109361797-109361819 TATGAATGTCTATAAATGACTGG - Intronic
912900375 1:113641163-113641185 TATAAATCTATATATATATCAGG + Intronic
913421588 1:118675778-118675800 CTTGAATTGCTATAAATACCTGG + Intergenic
915768240 1:158388968-158388990 TTTGAATCTGTTATAATATCTGG + Intergenic
916348139 1:163817875-163817897 TTTGTATATTTATAAATTTCAGG + Intergenic
917527715 1:175803743-175803765 TTTCTACCTCTATAAATGTCAGG + Intergenic
919409089 1:197221734-197221756 TTTGAATCACTATAAAATTGGGG + Intergenic
920276055 1:204805202-204805224 TTTATATCCCTAGAAATATCTGG - Intergenic
920949132 1:210556263-210556285 TTTGAATCTTTAAGAAAATCAGG - Intronic
921987022 1:221323148-221323170 TTTGCATCTCTCAAAATGTCAGG - Intergenic
923373023 1:233331210-233331232 TTTTAATTTCTATAATTGTCAGG + Intronic
924572675 1:245251964-245251986 TTTACATCTTTACAAATATCTGG + Intronic
1063548608 10:7006716-7006738 TTTGAATCACTGAAAATCTCTGG - Intergenic
1064376810 10:14803968-14803990 TTTCAGACTGTATAAATATCTGG - Intergenic
1065565486 10:27003491-27003513 TTTGAGGCTTTGTAAATATCTGG - Intronic
1067052790 10:43032618-43032640 TTTGATTCTATATAAATTTCTGG - Intergenic
1068387458 10:56350722-56350744 TTTGAATCCCTATAGCCATCAGG + Intergenic
1068505068 10:57890162-57890184 TTTGTATTTCTATAAATGTGTGG + Intergenic
1069522556 10:69136001-69136023 TTTAAATCTCTCTTAATCTCAGG + Intronic
1070096761 10:73345028-73345050 TTTGAATCTCTATAAATATCTGG + Intronic
1070180804 10:74011689-74011711 TTTGAGACTGTATAAATATTTGG - Intronic
1070349867 10:75581915-75581937 TTTTAATATATATAAATTTCTGG - Intronic
1072845338 10:98823881-98823903 TTTGGAGTTCTATAAATATTAGG - Intronic
1073570200 10:104574778-104574800 TCTGAAGATATATAAATATCAGG - Intergenic
1074091958 10:110268841-110268863 ATTGATTCTCTATTATTATCAGG + Intronic
1074258253 10:111825903-111825925 TTTGAATCTGTAAAGAAATCTGG + Intergenic
1074725649 10:116306009-116306031 TTTTATTCTCTGTAAATAACAGG - Intergenic
1075924941 10:126243945-126243967 TTTGCATCTCTATCAAAATCCGG + Intronic
1080057534 11:27922544-27922566 TTTGAATATATAAAAATATTAGG - Intergenic
1082899979 11:58237496-58237518 TATGACTCTCTATGAATCTCAGG + Intergenic
1084852863 11:71957395-71957417 TTGGGATCTCTCTAAGTATCTGG + Intronic
1085166342 11:74403662-74403684 TTTGAATTTTCATTAATATCTGG + Intergenic
1085373473 11:76034968-76034990 TTTTAATTTGTATAAATATAAGG + Intronic
1086524353 11:87707682-87707704 TTTGAAGCTATACAAATATTTGG - Intergenic
1086599088 11:88610208-88610230 TTTGATTCTGTATAAATTTTAGG + Intronic
1088591856 11:111410349-111410371 CTTGAATCTCTAGTTATATCAGG - Intronic
1090244018 11:125202891-125202913 TTTTAAACTCTAAAAATACCTGG - Intronic
1090590301 11:128260167-128260189 CTTGAATCTCCAGAAAGATCTGG - Intergenic
1091176220 11:133560478-133560500 CATGAATATTTATAAATATCAGG - Intergenic
1093003020 12:14020452-14020474 ATTCAATCTCTATGAATTTCAGG + Intergenic
1093156554 12:15693006-15693028 TCTGAATTGCTTTAAATATCAGG + Intronic
1093518800 12:20023302-20023324 TTTGAACTTCTATAAATTTGTGG - Intergenic
1093799409 12:23354470-23354492 GTTGAAGCTTTCTAAATATCAGG - Intergenic
1094368740 12:29712597-29712619 TGAAAATCTCTTTAAATATCTGG + Intronic
1097294840 12:57950989-57951011 AATGAATGTATATAAATATCTGG + Intronic
1097515689 12:60603178-60603200 TTTCACTCTCAATAATTATCAGG + Intergenic
1097873514 12:64621989-64622011 TTTGAATTTCAATAAATTTAGGG + Intronic
1098108822 12:67100179-67100201 TTTTTTTCTCTGTAAATATCTGG + Intergenic
1098195166 12:67992211-67992233 TTTGCATTTCTTTTAATATCTGG + Intergenic
1098838301 12:75447805-75447827 TTAGAATCTCTCTATATAGCAGG + Intergenic
1099445701 12:82748927-82748949 TGTGTATCTCTATATATATGTGG + Intronic
1099813939 12:87621215-87621237 TTTGAATCCATATATATATATGG + Intergenic
1100064727 12:90628324-90628346 TATGAATCACTTTAAATAACAGG + Intergenic
1100071296 12:90722219-90722241 TTTGAATTTCTATAACAATTTGG + Intergenic
1103007393 12:117432335-117432357 TTTGACTCTATAAAAATATTTGG + Intronic
1104195146 12:126529767-126529789 TTAGAATCTCCATAAATGTTGGG + Intergenic
1104679838 12:130742116-130742138 TTTGAAGCTGTGTAAATATCTGG - Intergenic
1105265632 13:18811570-18811592 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1106446512 13:29837336-29837358 TTTGAATCTATGTAAATTTTAGG + Intronic
1106566896 13:30893403-30893425 TTTGATTCTCCATAAACCTCAGG - Intergenic
1106798101 13:33228360-33228382 TATGAATCTATTAAAATATCAGG + Intronic
1106986823 13:35363168-35363190 TTTGGGGCTCTATAAATAACTGG - Intronic
1107090854 13:36477512-36477534 ATTGAATCACTATAATTCTCTGG - Intergenic
1107116272 13:36749683-36749705 TTTGACACCCAATAAATATCAGG - Intergenic
1107212939 13:37879705-37879727 TTTGGATCTCTATAATATTCTGG - Intergenic
1107468088 13:40666850-40666872 TTTGGATCTCTATTATTTTCTGG + Intergenic
1108787672 13:53925401-53925423 TTTGATTCCCTATGAATTTCAGG - Intergenic
1108963088 13:56261807-56261829 TTTGAATCTCTAAAAAAATTGGG - Intergenic
1109286520 13:60415745-60415767 TTTAAAACTCAATAAATCTCTGG - Intronic
1110107684 13:71698807-71698829 TTTAAAATTCTTTAAATATCTGG + Intronic
1110666086 13:78118871-78118893 TTTGAATCTCCTAAAATATCTGG - Intergenic
1111006492 13:82256612-82256634 TATCAATCTCTATAAATTTAAGG - Intergenic
1112137524 13:96598162-96598184 TTTGGTTCTATATAAATTTCAGG + Intronic
1112260578 13:97874450-97874472 TTTGAATGTCTATAAACACATGG + Intergenic
1112710701 13:102124788-102124810 TATGAATATATATAAATAACAGG - Intronic
1112815824 13:103272025-103272047 TTTATATGTCTATAATTATCAGG + Intergenic
1112820623 13:103330266-103330288 TTTGAATTTGTATATAAATCTGG + Intergenic
1113282392 13:108803300-108803322 TTTTAATTTCTATAAATATTGGG + Intronic
1113712327 13:112475783-112475805 TTTGAATCTCTGTTATTATTAGG - Intergenic
1115476999 14:33825080-33825102 TTGGAAACTCTACAAATATGTGG + Intergenic
1116278775 14:42873569-42873591 TTTTCATCATTATAAATATCTGG - Intergenic
1116438733 14:44925405-44925427 TTTGGAGTTCTATAAATATTAGG + Exonic
1117065221 14:52006823-52006845 TTTGAATCTCTACTAAAAACTGG - Exonic
1118660904 14:68010371-68010393 TCTGAATTTCTATAAATCTGTGG - Intronic
1119065354 14:71520168-71520190 TCTGAAACTATATAAATATCTGG - Intronic
1120558020 14:85954580-85954602 TTTCAATCTCTAAAAATGGCTGG + Intergenic
1120694708 14:87631678-87631700 TTTAAATCTCTAAATATATATGG + Intergenic
1120733727 14:88030559-88030581 ATTCAATCTCTACAAATATCCGG + Intergenic
1123111769 14:105873498-105873520 TTGGAAACTATATAAATATATGG - Intergenic
1202832875 14_GL000009v2_random:56549-56571 TTTGAGGCTCTGTAAATATCTGG + Intergenic
1124108163 15:26760866-26760888 TTTGAATCTCTTTGAATTTCCGG + Intronic
1127181263 15:56420919-56420941 TTTGAATCACTCTAAATTTATGG + Intronic
1128872192 15:71168558-71168580 TTAGAGTTTCTATAAATAACAGG - Intronic
1129042829 15:72704981-72705003 TTTGAACCTCTTTATATATTAGG + Intronic
1129480906 15:75825180-75825202 TTTTTATCTCTATAAAAATGAGG + Intergenic
1129776718 15:78241680-78241702 TTTGAATCTCCAAAAATCTCTGG - Intronic
1130271792 15:82455383-82455405 TATAAATATCTATAAATAGCTGG + Intergenic
1130464143 15:84182772-84182794 TATAAATATCTATAAATAGCTGG + Intergenic
1130488544 15:84412063-84412085 TATAAATATCTATAAATAGCTGG - Intergenic
1130500123 15:84490769-84490791 TATAAATATCTATAAATAGCTGG - Intergenic
1130586439 15:85187405-85187427 TATAAATATCTATAAATAGCTGG + Intergenic
1133686256 16:8168128-8168150 TATGAAACTTTAAAAATATCTGG + Intergenic
1133713459 16:8424739-8424761 TTTAACTGTTTATAAATATCAGG + Intergenic
1134401697 16:13915878-13915900 TTTGTATGTCTATAAAGTTCTGG + Intergenic
1136694045 16:32060446-32060468 TTAGAATCTATTTTAATATCAGG - Intergenic
1136794540 16:33003710-33003732 TTAGAATCTATTTTAATATCAGG - Intergenic
1137613308 16:49833345-49833367 TATGAAACTGTATAAATACCGGG - Intronic
1140641796 16:76982910-76982932 TTTTAATCTGTATAAATATATGG + Intergenic
1140831036 16:78751611-78751633 TTTGTATCTACATAAATATAAGG - Intronic
1203096802 16_KI270728v1_random:1265360-1265382 TTAGAATCTATTTTAATATCAGG - Intergenic
1143774665 17:9190470-9190492 TTACAATATCTTTAAATATCTGG - Intronic
1144243653 17:13340478-13340500 GTTAAATCTCTAAAATTATCAGG - Intergenic
1144343446 17:14330226-14330248 GTAGAACCTCTATAAATATTTGG - Intronic
1144616955 17:16785172-16785194 TTTGAGGCTCTGTAAATATCTGG + Intronic
1144895737 17:18530502-18530524 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1145136480 17:20413730-20413752 TTTGAGGCTCTGTAAATATCTGG + Intergenic
1146364957 17:32216506-32216528 TTTGGGTCTCTGTAAATATTCGG - Intronic
1151881204 17:76895905-76895927 TTTGAATTTCTTTAAAAATCGGG - Intronic
1153303533 18:3612259-3612281 GCTGAATCTCTATAAACATCTGG + Intronic
1153447896 18:5194900-5194922 TCTAAATCTCTATAATAATCTGG - Intronic
1154422767 18:14249958-14249980 TTTGAGGCTCTGTAAATTTCTGG + Intergenic
1155077803 18:22376937-22376959 ATTGAATCTATATCAATATGGGG - Intergenic
1155850016 18:30762430-30762452 TTTTAATCTATATATATAGCTGG - Intergenic
1155912593 18:31521753-31521775 TTTGTATCTTAATAGATATCAGG + Intronic
1156381353 18:36564316-36564338 TTTGAACCTCTAAAAATTTTTGG - Intronic
1156523858 18:37747624-37747646 GCTGAATTCCTATAAATATCTGG - Intergenic
1156617341 18:38802978-38803000 TTTGAATCTATAATTATATCTGG + Intergenic
1156658221 18:39312841-39312863 TTTGAATCATTATAAAAGTCTGG + Intergenic
1156844975 18:41655428-41655450 TTTGAGACTCTATAATTATGCGG + Intergenic
1157132441 18:45019473-45019495 TTTAAATCTCTTTAAAAGTCTGG + Intronic
1159386651 18:67734811-67734833 TTTGAATGTCTATAGATTTGGGG - Intergenic
1160134157 18:76257937-76257959 TTTCAACCTCTATAAATACAGGG - Intergenic
1163375835 19:16929870-16929892 TTTGAATCTGTAGAACCATCTGG - Intronic
1166210196 19:41302019-41302041 TTTGTTTCTCTGTAAATATAGGG + Intronic
1167815318 19:51875659-51875681 TTTGAATCTCTGAATATATGTGG + Intronic
1202639806 1_KI270706v1_random:71175-71197 TTTGAGGCTCTGTAAATATCTGG - Intergenic
925473733 2:4189988-4190010 TTTGAATCTCTACATGTGTCAGG + Intergenic
925790515 2:7481424-7481446 TTGGAAACTCTACAAATATATGG + Intergenic
926990467 2:18674830-18674852 TCTGAATCTCTATCAAGACCAGG + Intergenic
928993252 2:37258016-37258038 TTTGAGCCTCTAGAAAAATCTGG - Intronic
930482843 2:51971229-51971251 TGTGAATGGCTATAAACATCTGG + Intergenic
930552856 2:52857462-52857484 TTTTTTTCTCTATAAAGATCTGG - Intergenic
931575472 2:63713924-63713946 CCACAATCTCTATAAATATCAGG - Intronic
931580787 2:63770844-63770866 TTTAAATCTCTTTTAATGTCAGG - Intronic
931594292 2:63924513-63924535 TTTTAATCCATATTAATATCTGG - Intronic
931960798 2:67480124-67480146 TTTTACTGTCCATAAATATCTGG - Intergenic
932996439 2:76859863-76859885 TTTGAATATAAATAAATATATGG + Intronic
933066226 2:77801644-77801666 TTTACATCACTATAAATATTAGG - Intergenic
933098410 2:78218211-78218233 TTAGAATTTCTATACATCTCTGG + Intergenic
933370819 2:81413249-81413271 CTTGCATCACTATAAATACCTGG + Intergenic
935877194 2:107522680-107522702 TGTCAATTTCTATAAACATCTGG + Intergenic
936557143 2:113506011-113506033 TTTATATTTCTATAAATATATGG - Intergenic
937154795 2:119711273-119711295 TATAAATCTCTAAAAAGATCTGG + Intergenic
938017505 2:127879537-127879559 TTTGCATTGCTATAAATACCTGG - Intronic
939041910 2:137199930-137199952 GTTGCATCTCTAGAAATATTTGG - Intronic
940622953 2:156136425-156136447 TCTGAATTTCTCTAAATATGTGG - Intergenic
941192670 2:162405339-162405361 TTTGAATGTCTTTAAATTTGGGG - Intronic
942428867 2:175888304-175888326 TTTGAATCAGTTGAAATATCTGG - Intergenic
942677038 2:178438223-178438245 TTTGAAACAGTATAAATATTAGG - Intronic
943473652 2:188327857-188327879 TTTGAACCACCATAAATATTAGG - Intronic
943499787 2:188672846-188672868 TATGTATCTCTATAAATAACTGG - Intergenic
943649331 2:190440147-190440169 TGTGAATCTCCACAAATATATGG - Intronic
944356019 2:198788889-198788911 TTTGAAGCTATTTAAATACCTGG + Intergenic
945742966 2:213685904-213685926 TTTCAATCTCTATTAAAAACTGG + Intronic
946520153 2:220455899-220455921 TTTGCAACTGTATAATTATCAGG + Intergenic
947038244 2:225885055-225885077 TTTGATTCTCTACACATCTCAGG + Intergenic
947286701 2:228524707-228524729 TTTAAATTTGTATAAATATATGG - Intergenic
947709109 2:232300557-232300579 TTTAAATCTCTGTAAGTACCCGG - Intronic
1170432354 20:16288030-16288052 TTTGAATCTACATAAATGTTTGG + Intronic
1171247868 20:23627656-23627678 TTGGAATCTTTATACATAGCTGG - Exonic
1171886471 20:30655532-30655554 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1175451010 20:59068147-59068169 TTTCATTGTCTATAAATAACTGG + Intergenic
1176648136 21:9368775-9368797 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1176850698 21:13910001-13910023 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1177430782 21:20989796-20989818 TTTTAATCTATATATATTTCTGG + Intergenic
1177613921 21:23491741-23491763 ATTGAATCTGTATATATATTTGG - Intergenic
1178434727 21:32547932-32547954 TTTAAATTTATATAAATATATGG + Intergenic
1179094723 21:38302992-38303014 TTTCAATTTATCTAAATATCTGG + Exonic
1180362134 22:11910695-11910717 TTTGAGGCTCTGTAAATATCTGG + Intergenic
1181455099 22:23054810-23054832 TTTTCATCTCTATATATATTTGG + Intergenic
1181578691 22:23814289-23814311 TTTGCATCTTTGTAAAAATCAGG - Intronic
1182887492 22:33787873-33787895 TGTCATTCTCTATAAATAGCAGG - Intronic
1183133284 22:35860705-35860727 TGTCAATTTCTACAAATATCTGG + Intronic
1184578017 22:45389672-45389694 TTTTTATCACTATAAATACCAGG + Intronic
950812069 3:15658542-15658564 TTTGACTCACTCTGAATATCCGG - Intergenic
951333769 3:21396719-21396741 TTGGAATATATATATATATCAGG - Intergenic
951515120 3:23550416-23550438 TTTTACTCTGTATAAATCTCAGG + Intronic
951792568 3:26502462-26502484 TATGAATCTCTATCAATTTGTGG + Intergenic
951814648 3:26740568-26740590 TTTGAAGCTTTACAAATATTTGG - Intergenic
951938696 3:28053016-28053038 TTTTTATCTCATTAAATATCCGG - Intergenic
952779164 3:37077272-37077294 CTTGAATGTCTATTAATATAGGG + Intronic
954968536 3:54632591-54632613 CTTAAGTCTCAATAAATATCTGG - Intronic
957152838 3:76508732-76508754 TTTGAATCTTTTTAAATATTTGG - Intronic
957198779 3:77105363-77105385 TTTGCATTTCTACAAATGTCAGG + Intronic
957412059 3:79855001-79855023 TTTGAATCTGTTCATATATCTGG + Intergenic
957646477 3:82937711-82937733 TTTGAAGCTCTATAACTGTGTGG - Intergenic
957746713 3:84353232-84353254 TTTGTATCTTTATGAATATCTGG + Intergenic
958102125 3:89025973-89025995 TTTTAATCTAGATACATATCTGG - Intergenic
958483419 3:94674802-94674824 TTTTAATCAGTATAAAAATCCGG + Intergenic
959083872 3:101830970-101830992 TTTTAATGTCTCCAAATATCTGG - Intronic
959778077 3:110193629-110193651 TTTTCATCCTTATAAATATCTGG + Intergenic
960482466 3:118209780-118209802 TTGGAAACTGTATAAATATCTGG + Intergenic
961842483 3:129727553-129727575 TTTACATCTTTATAAATAACAGG + Intronic
962481544 3:135802528-135802550 TTAGAATTTCTATACATCTCTGG - Intergenic
963405499 3:144858071-144858093 TTTAAATTTCTATAAATTTATGG - Intergenic
964290597 3:155175885-155175907 TATTGATATCTATAAATATCAGG - Intronic
964417306 3:156460938-156460960 TTCATATCTCTATAAATATTTGG - Intronic
964507890 3:157419583-157419605 TTTGAATTTCTCTAATGATCAGG - Intronic
965204729 3:165707000-165707022 TTGGCATCTCTATAAAAATACGG + Intergenic
966880296 3:184346264-184346286 TGTAAATCTCTATATACATCTGG + Exonic
1202738749 3_GL000221v1_random:36212-36234 TTTGAGGCTCTGTAAATATCTGG + Intergenic
970633210 4:17977857-17977879 TTTAAATCTCTATAACTTTTAGG - Intronic
971312667 4:25538885-25538907 TTTGAAAAGCTATAAATCTCTGG + Intergenic
971320910 4:25605213-25605235 TCTGAATTTCTAAAAACATCTGG - Intergenic
971681781 4:29709347-29709369 TTTTAAGTTCTTTAAATATCAGG - Intergenic
972415503 4:38835822-38835844 TTTGAAACTGTATAAATACATGG + Intronic
973945589 4:55951239-55951261 TTTTTATTTCTATAAATACCTGG + Intronic
974746415 4:66084014-66084036 CTAGAATTTCTATAAATTTCTGG - Intergenic
975312821 4:72922097-72922119 TTTGAAGCTATACAAATATATGG - Intergenic
975358115 4:73431994-73432016 TTTTAATGTCTATAAGTACCAGG + Intronic
976603170 4:86957966-86957988 TGTGCATCTCTAAAAATATATGG + Intronic
977073998 4:92430596-92430618 TGTGATTCTCTATACATTTCAGG + Intronic
977354775 4:95931887-95931909 TTCGAAATTCTATAAAAATCAGG - Intergenic
977387589 4:96362714-96362736 TTTGAATGTCAAAAAATATCAGG + Intergenic
979144721 4:117229992-117230014 CTTGAATATCTATACATTTCTGG + Intergenic
979617759 4:122763434-122763456 ATAGAAACCCTATAAATATCTGG + Intergenic
980022249 4:127723551-127723573 TTTGATTCTCTTTAAGTTTCAGG + Exonic
980383114 4:132051904-132051926 TTTAAGTCTCTAAAAATGTCAGG + Intergenic
980802573 4:137770670-137770692 TCTGGATCCCTATAAATATAAGG + Intergenic
981346152 4:143678611-143678633 TTTGAATCTCTAAAACATTCTGG - Intronic
981389779 4:144175115-144175137 TTTGAATCTCCACAAATTTAGGG - Intergenic
982273172 4:153612492-153612514 TTTGAATCCATATTAATAACTGG + Intronic
982688389 4:158520290-158520312 TTTTAATCTCTCAAATTATCAGG - Intronic
982847053 4:160267353-160267375 TTTCAATCTCTTTGGATATCTGG - Intergenic
982928222 4:161367030-161367052 TTTGAATTTCTAATAATTTCTGG - Intergenic
982993814 4:162315838-162315860 TTTACATCTCTAGCAATATCAGG + Intergenic
983083755 4:163418306-163418328 TTTCAATATCAATAAATATCAGG + Intergenic
983258358 4:165427796-165427818 TTAGAATCTCTGTGAATCTCAGG + Intronic
983336863 4:166405997-166406019 TTTGAATCATTAGAAATGTCTGG + Intergenic
1202767164 4_GL000008v2_random:157030-157052 TTTGAGGCTCTGTAAATATCTGG - Intergenic
987217847 5:15756932-15756954 TTTGATTATCTGTAAAAATCAGG + Intronic
987741608 5:21916083-21916105 TTTGAACATCTATAAGTACCAGG + Intronic
987845596 5:23278886-23278908 TTTTAATCTTTATAAATTTAAGG - Intergenic
987952485 5:24693329-24693351 TTAGCATCTAAATAAATATCAGG - Intergenic
990926637 5:61032791-61032813 ATTGAATCTGTATAAATTTTGGG + Intronic
992106715 5:73454081-73454103 TTTGCAGCTCTATAAACTTCTGG + Intergenic
992450991 5:76875608-76875630 TTTGAATCTCTGTACAAATTTGG - Intronic
992826778 5:80556879-80556901 TTTAAATACCTATAAATATCAGG + Exonic
993266733 5:85735077-85735099 TTTAAATATCTTTAAATGTCAGG + Intergenic
993288477 5:86033455-86033477 GATGAATCCCTAGAAATATCAGG - Intergenic
993898274 5:93564772-93564794 TTTTGATCTCTTTAAATACCAGG - Intergenic
993985246 5:94589481-94589503 TTTGAATCTCTATCAAAGTTGGG + Intronic
994401788 5:99289328-99289350 TTTGAATCTTCATATTTATCTGG + Intergenic
994404260 5:99324131-99324153 TTTGCATTTCTCTAAAGATCAGG - Intergenic
994847730 5:105011442-105011464 TTTGAATCTCTTTTAGTGTCAGG + Intergenic
995210430 5:109531432-109531454 TTAGTTTCTCTATAAATATTTGG + Intergenic
996585242 5:125080106-125080128 TCTGAATTTATATATATATCTGG - Intergenic
997310737 5:132879185-132879207 TAAGAAGCTCTATAAATATGAGG + Exonic
997320610 5:132975143-132975165 TTTGAATCACAAGAAATGTCAGG - Intergenic
997826089 5:137108176-137108198 TTTGAACCTCAATAAATAAGTGG + Intronic
1001903792 5:175453961-175453983 CTTGAGACTCTATAAATCTCTGG - Intergenic
1002970471 6:2012244-2012266 TTTGTATTTCTATAAATTTAGGG - Intronic
1005108956 6:22257346-22257368 ATTGAATCTCTATTAATCTGGGG + Intergenic
1005410545 6:25540752-25540774 TCTGAATTTCTATAATTATTTGG + Intronic
1005434254 6:25791354-25791376 TTTTAATATTTGTAAATATCAGG - Intronic
1007991088 6:46256698-46256720 TTTGAGTCTTTTTAAAAATCTGG - Intronic
1008538897 6:52529286-52529308 TTTGTTTTTCTATAAATATTTGG - Intronic
1008610007 6:53176917-53176939 TTTAAATCTTTATAGATATAGGG - Intergenic
1011767002 6:90632160-90632182 TTTATTTCTCTATAAATAACAGG - Intergenic
1011777115 6:90743291-90743313 TTTGATTCTTTAAAAAAATCAGG + Intergenic
1011819859 6:91239673-91239695 TTTTCATTTCAATAAATATCTGG + Intergenic
1012653536 6:101787590-101787612 TTTGAAACTCTACAAATATATGG - Intronic
1012696749 6:102393518-102393540 TTTGATTCTGTATGAATATTAGG - Intergenic
1013859856 6:114622758-114622780 TTTGTTTCTCTATGAATATTCGG + Intergenic
1014506164 6:122259964-122259986 TTTGAATCTGTGTAACTCTCTGG - Intergenic
1014989158 6:128052744-128052766 TTTGAAACTATGTAAATACCTGG + Intronic
1015088012 6:129319521-129319543 TTTGAAGCTGTTTAAATTTCTGG - Intronic
1016331421 6:142956243-142956265 TTTGCATGATTATAAATATCAGG + Intergenic
1016504526 6:144763962-144763984 TTTGAATCTCTTTCAAGAACTGG + Intronic
1016505360 6:144772943-144772965 TTTTAATCTCTTTAAATGTTGGG + Intronic
1016538104 6:145131866-145131888 TTTGAAACTATACAAATATATGG - Intergenic
1016538535 6:145136744-145136766 TTTGAATCTCTGAACACATCAGG + Intergenic
1018330075 6:162718028-162718050 TTTGTATATGTAAAAATATCAGG - Intronic
1020484723 7:8707033-8707055 TTTTAATTTCTATAAATTTATGG - Intronic
1021357533 7:19670689-19670711 TTTCAAGCTCTATATATGTCAGG - Intergenic
1021897844 7:25254083-25254105 TATGAATCCCTATAAATAAAAGG + Intergenic
1022601629 7:31766057-31766079 ATTGCATATCTACAAATATCAGG - Intronic
1023933707 7:44724068-44724090 TTAGAATTTCTATACATCTCTGG - Intergenic
1024252562 7:47517475-47517497 TTTGTATCTTTACAAACATCTGG - Intronic
1024663846 7:51526058-51526080 TTTGAATTGCTTTGAATATCAGG - Intergenic
1024732597 7:52269925-52269947 TTTGAATCACCACAAATATCTGG + Intergenic
1027379518 7:77591793-77591815 TGACAATCTCTACAAATATCTGG - Intronic
1027685123 7:81270278-81270300 TTTTAATCTCAATAGACATCTGG + Intergenic
1027693516 7:81378560-81378582 TTGGAATATCTACAAATATTTGG + Intergenic
1028269584 7:88772370-88772392 TTTAAATCTCTATGATCATCAGG + Intronic
1030327817 7:108239793-108239815 TGTGAATCTTTATAAACACCAGG + Intronic
1030471260 7:109965247-109965269 TTTCAATCGATAGAAATATCAGG + Intergenic
1031092268 7:117372983-117373005 TTAGAATGTTTATAAATAACAGG + Intronic
1031289711 7:119917720-119917742 TTTAATTCTTTTTAAATATCTGG + Intergenic
1031381767 7:121094798-121094820 TTTCAATATCTTTTAATATCTGG - Intronic
1031638833 7:124137169-124137191 TTTGAAACTATACAAATATATGG - Intergenic
1031757278 7:125660856-125660878 TTTGAATCAGTATTAACATCTGG + Intergenic
1031830960 7:126624512-126624534 TTTAAATATCTAAAAATATTTGG + Intronic
1032378789 7:131453281-131453303 ATTGTAGCTTTATAAATATCTGG - Intronic
1032605383 7:133345283-133345305 TTAGAATCTCTATCAGTTTCTGG - Intronic
1033496095 7:141897799-141897821 TTTGAGTATCTGTAAATGTCAGG + Intergenic
1033890814 7:146011127-146011149 TTTTAATCTTTATAAATATTTGG - Intergenic
1035100837 7:156395040-156395062 TTGTTATATCTATAAATATCTGG - Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035905578 8:3506306-3506328 TTTGGATGTCTAGAAATAGCGGG - Intronic
1036216760 8:6886720-6886742 TTAGAAGCTCTTTATATATCTGG - Intergenic
1036724970 8:11211975-11211997 TTTGAAGATTCATAAATATCAGG + Intergenic
1036942912 8:13068384-13068406 TTTTAATCTCTAGAAACTTCAGG + Intergenic
1037740864 8:21608235-21608257 TATGAATCTCTGGAAATAACTGG - Intergenic
1037972990 8:23187709-23187731 TTGGAATTTCTAGAAATATTAGG - Intergenic
1038062301 8:23926862-23926884 TTTGAAACTCTAGAAACACCAGG - Intergenic
1038413877 8:27379009-27379031 GTTTCATCTCTATAAAAATCGGG - Intronic
1038493935 8:27988778-27988800 TCTGATTCTCTTTAACTATCTGG + Intronic
1039101000 8:33941970-33941992 TTTGAATCACTATAAATGCCAGG - Intergenic
1039213608 8:35242820-35242842 TTTGCCTCTAAATAAATATCTGG + Intronic
1039316609 8:36380474-36380496 TTTGAATTTTTATAACTATGAGG - Intergenic
1040101401 8:43510329-43510351 TTTGAGGCTCTGTAAATATCTGG + Intergenic
1040640282 8:49326233-49326255 ATTATATCTTTATAAATATCAGG - Intergenic
1040646948 8:49409689-49409711 GTTGAGTATCTATAGATATCTGG + Intergenic
1040896880 8:52377104-52377126 TTTGAATCTCTATTAGTACATGG + Intronic
1041474378 8:58248097-58248119 GTTGATGCTCTATAAATATCAGG - Intergenic
1042855937 8:73267493-73267515 TTTGAAACCCAATACATATCAGG + Intergenic
1042952005 8:74210116-74210138 TTTGACTGTCTCTAAATTTCAGG + Intergenic
1043375563 8:79645530-79645552 TTTGAATCTGAATAATTATCTGG - Intronic
1043656897 8:82678924-82678946 TTTGAATCTCAATGATCATCAGG + Intergenic
1043674100 8:82927671-82927693 TTTGCATTTGTATAAATTTCTGG - Intergenic
1044394870 8:91699659-91699681 TTGGAAACTATATAAATATATGG - Intergenic
1045079717 8:98612459-98612481 TTAGAATCTCTCTATATATATGG - Intronic
1045711514 8:104990091-104990113 TTTCAAGCTATAGAAATATCTGG - Intronic
1045901471 8:107286290-107286312 TTTAATTTTTTATAAATATCCGG + Intronic
1045940606 8:107734247-107734269 TTTAAAGCTCTATAAATTTTTGG + Intergenic
1046710731 8:117508680-117508702 TTTGCTTCTCTATGAATATATGG - Intergenic
1048230275 8:132633054-132633076 TTTAATTCTCTATCACTATCGGG - Intronic
1048769374 8:137879596-137879618 TGTAAATATCCATAAATATCAGG - Intergenic
1049667799 8:143855100-143855122 TTTAAATCATTAAAAATATCTGG + Intergenic
1049895853 9:111290-111312 TTTATATTTCTATAAATATATGG + Intergenic
1049911850 9:276428-276450 TTTTAAAAACTATAAATATCAGG + Intronic
1049965823 9:778443-778465 TTAGAAACTCTATAAATAAATGG + Intergenic
1050059815 9:1695117-1695139 TTGGAAAATCTATAAGTATCTGG + Intergenic
1050362799 9:4846791-4846813 TTTATATCCCTATAAATAGCAGG + Intronic
1050378685 9:5000818-5000840 TTGGGATATGTATAAATATCAGG + Intronic
1050760054 9:9057992-9058014 TTGAAATCGTTATAAATATCAGG - Intronic
1050930045 9:11311567-11311589 TTTGGATGTCTTTCAATATCTGG + Intergenic
1052064329 9:23998160-23998182 TGTGATTCTCTATAAATTTTAGG - Intergenic
1052473975 9:28934561-28934583 TTTCAATCCCTAAAAAAATCAGG + Intergenic
1052876624 9:33572837-33572859 TTTGAAGCTCTGTAAATATCTGG + Exonic
1053499376 9:38571508-38571530 TTTGAAGCTCTGTAAATATCTGG - Intronic
1053739035 9:41121473-41121495 TTTATATTTCTATAAATATATGG + Intergenic
1054689314 9:68309849-68309871 TTTATATTTCTATAAATATATGG - Intergenic
1055999501 9:82199790-82199812 TTTAAATTTCCATAAGTATCTGG - Intergenic
1056153420 9:83811225-83811247 TTTGAAACTTTATCAACATCTGG + Intronic
1056357216 9:85813189-85813211 TTTGAAACTTTATCAACATCTGG - Intergenic
1056586960 9:87933498-87933520 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1056609914 9:88119442-88119464 TTTGAGGCTCTGTAAATATCTGG + Intergenic
1057162440 9:92897889-92897911 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1057549710 9:96043351-96043373 TTTTCATCTCTAGAAATTTCTGG - Intergenic
1057678800 9:97156033-97156055 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1058617032 9:106841286-106841308 TTTTTATATCTATAAATTTCTGG + Intergenic
1058663901 9:107291629-107291651 TTTGTATTTGTAGAAATATCAGG + Intronic
1059582189 9:115563540-115563562 ATTCAATTTCTATAAATCTCTGG + Intergenic
1059624832 9:116051874-116051896 TTTCAATCTATGTAAATATCAGG + Intergenic
1203691900 Un_GL000214v1:50094-50116 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1203707479 Un_KI270742v1:66656-66678 TTTGAGGCTCTGTAAATATCTGG + Intergenic
1203547914 Un_KI270743v1:141907-141929 TTTGAGGCTCTGTAAATATCTGG - Intergenic
1203644395 Un_KI270751v1:54097-54119 TTTGAGGCTCTGTAAATATCTGG + Intergenic
1185861685 X:3585232-3585254 CTTGAATCTCAATAAAAATGTGG + Intergenic
1186055347 X:5643910-5643932 TTAGAATCTCTACACATATTAGG + Intergenic
1186266194 X:7836527-7836549 CTTGGATCGATATAAATATCTGG + Intergenic
1188208229 X:27385879-27385901 ATTGATTCTGTATAAATATATGG + Intergenic
1188770309 X:34146527-34146549 TTAGTATCTGTAAAAATATCTGG + Intergenic
1189623173 X:42865744-42865766 TTTTAATCTTTAAAAATATATGG + Intergenic
1189830555 X:44968607-44968629 TGTAAATATCTATAAATATGTGG + Intronic
1191806479 X:65140647-65140669 TTAGTTTCTCTCTAAATATCTGG + Intergenic
1192040454 X:67614785-67614807 TTTGAATATATTTAAATAGCTGG - Intronic
1192291317 X:69798516-69798538 TTGGAAACTCTACAAATACCTGG + Intronic
1193708248 X:84849457-84849479 TTTGCATTTCTCTAATTATCAGG - Intergenic
1193710986 X:84879555-84879577 TTTGCATTTCTCTAATTATCAGG + Intergenic
1194006835 X:88504988-88505010 TGTGAATGTTTATCAATATCTGG - Intergenic
1194638809 X:96377402-96377424 TTTGAATGTTTGTAAATATGTGG - Intergenic
1195443494 X:104923260-104923282 TTTGCATCTCTAGGAAGATCAGG - Intronic
1196481697 X:116157603-116157625 TGTGAATTTCTAAAAATTTCTGG - Intergenic
1196696987 X:118623857-118623879 TTTGAGTGTATATACATATCTGG + Intronic
1197113125 X:122799930-122799952 TGTGATTCCATATAAATATCAGG - Intergenic
1197608730 X:128614819-128614841 TTTGAATCTCAAAAAATGTGTGG + Intergenic
1198455058 X:136808804-136808826 GCTAAATCTCTATAAATAACAGG + Intergenic
1199146995 X:144380238-144380260 TTCAAATTTCCATAAATATCTGG - Intergenic
1199212707 X:145232720-145232742 TTGGAATCTCCAGAACTATCAGG - Intergenic
1199829952 X:151539560-151539582 GTTGACTCTCAATAAATATTTGG - Intergenic
1200332557 X:155312975-155312997 TTTGAATTTCTCTAATTATCAGG - Intronic
1201322815 Y:12719231-12719253 TTTTAATCTCTTTAATTATGAGG + Intronic
1202351055 Y:23992026-23992048 ATTGACTCATTATAAATATCAGG + Intergenic
1202519724 Y:25678093-25678115 ATTGACTCATTATAAATATCAGG - Intergenic