ID: 1070097627

View in Genome Browser
Species Human (GRCh38)
Location 10:73353340-73353362
Sequence ATGTGTTAGTGGAAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070097627 Original CRISPR ATGTGTTAGTGGAAGTGTGC AGG (reversed) Intronic
901619166 1:10568332-10568354 ATCTGTTAGTGGGAGTGGGGGGG - Intronic
901756521 1:11444676-11444698 ATGAGTGAGTGGGAGAGTGCGGG - Intergenic
904043205 1:27595898-27595920 GTGTGTGTGTGGAAGTGTGTGGG + Intronic
904911475 1:33937454-33937476 ATGGGGAAGTGGAAGTGGGCAGG + Intronic
904936398 1:34132554-34132576 ATGTGTTTGTGAAGGTGTTCAGG + Intronic
905892569 1:41526508-41526530 ATGTGTGAGGGCAAGTGTGACGG - Intronic
907542593 1:55229659-55229681 ATATGATTGTGGAAGTCTGCAGG - Intergenic
908466014 1:64396364-64396386 TTGTGTTAGTGGTACTGTGAGGG - Intergenic
908966066 1:69765066-69765088 ATGTGTTGATGTAAGTGTGTAGG - Intronic
910681155 1:89866562-89866584 TTGTGTTTCTGGAAGTGTTCTGG + Intronic
912638361 1:111320116-111320138 CTGTGGGAGTGGAAGTGTGGAGG - Intronic
913426483 1:118737058-118737080 ATGTGTTAGTGGCATGGTACTGG - Intergenic
914915377 1:151816121-151816143 CTGTGGTGGTGGAGGTGTGCAGG + Intronic
917716254 1:177740959-177740981 ATGTGTTATTGGAACTTGGCTGG - Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
921936946 1:220804304-220804326 ATGTGTTGGTTTAACTGTGCTGG - Intronic
922855357 1:228770400-228770422 CTGTGTCAGTGGAAGGGTGCAGG + Intergenic
924625193 1:245691467-245691489 ATGTGGCAGTGGAGATGTGCTGG + Intronic
1063599202 10:7464751-7464773 ATGATTTATTGGAAGTGGGCTGG + Intergenic
1064045445 10:12010209-12010231 ATGTTTTATTGGATGTGTCCTGG - Intronic
1067838861 10:49660107-49660129 ATGGGAGAGTAGAAGTGTGCTGG + Intronic
1068544879 10:58334564-58334586 ATGAGTTTGTGCATGTGTGCAGG + Intergenic
1070097627 10:73353340-73353362 ATGTGTTAGTGGAAGTGTGCAGG - Intronic
1070325664 10:75387267-75387289 ATCTGTGAGTGGAAGTGCACAGG + Intergenic
1074307725 10:112294416-112294438 GTGTGCAAGAGGAAGTGTGCAGG + Intronic
1078122839 11:8527814-8527836 ATGTAGTAGTGGAAGTGTTTTGG - Intronic
1078341964 11:10503741-10503763 ATGTCTTAATGGAAGTCAGCAGG + Intronic
1079114169 11:17630075-17630097 ATGTGTTAGTGCATGTGTAGAGG - Intronic
1079658566 11:23012736-23012758 AAATGTATGTGGAAGTGTGCAGG - Intergenic
1081739401 11:45427588-45427610 ATGTGCGAGAGCAAGTGTGCAGG - Intergenic
1082225967 11:49707205-49707227 ATGTGTTGGTGGGAGTGGGGAGG - Intergenic
1083256252 11:61497806-61497828 ATGTGTGAGTGTATGTGTGTGGG + Intergenic
1083979292 11:66152963-66152985 TTCTTTTAGTGGAAGTCTGCTGG - Intronic
1084494902 11:69498041-69498063 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084494982 11:69498341-69498363 ATGTGTAGGTGGAAGGGTGCAGG + Intergenic
1084495032 11:69498541-69498563 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1086360661 11:86055581-86055603 ATGTGGAAATGGAATTGTGCAGG - Intronic
1087284277 11:96247859-96247881 ATGTGTTGGTGGAAGGTTGTTGG - Intronic
1088846261 11:113670793-113670815 ATGTCTATGTGTAAGTGTGCAGG - Intergenic
1088961199 11:114666932-114666954 ATATGTGTGTGGATGTGTGCAGG - Intergenic
1090611255 11:128472917-128472939 CTGTGTTAGTTTGAGTGTGCCGG - Intronic
1091710853 12:2739125-2739147 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1093494646 12:19741974-19741996 ATTTTTTAGTAGTAGTGTGCTGG - Intergenic
1094441789 12:30485776-30485798 ATGTCTTGGAGGAAGTGTGGAGG - Intergenic
1095608111 12:44094783-44094805 ATGTGTTAGTGTGTGTGTGGGGG + Intronic
1097956085 12:65486707-65486729 GTGTGTTTGTGGCAGTGGGCAGG - Intronic
1099490824 12:83285984-83286006 AAGTGGTAGTGGAGGTGTGTGGG + Intergenic
1100655174 12:96636252-96636274 ATCTGTTAGTAAAAATGTGCAGG - Intronic
1101008578 12:100426828-100426850 ATGTGTTAGGTCAAGTGTCCAGG + Intergenic
1101806315 12:108067323-108067345 ATGTGTTTGTGGTTGTATGCAGG + Intergenic
1104002093 12:124866238-124866260 ATGTGTCAGTGCAACTGAGCTGG + Intronic
1104268260 12:127258682-127258704 CAGTGTTATTGGAAGTGTACAGG + Intergenic
1104348056 12:128020573-128020595 ACGTGTTCGTGGGAGTGGGCTGG + Intergenic
1104816317 12:131647880-131647902 ATGTGTGAGAGTGAGTGTGCAGG - Intergenic
1105339099 13:19503076-19503098 ATGGGTTAGTGGATGTGTTTGGG + Intronic
1109144833 13:58766344-58766366 GTGTGTTTGTGTATGTGTGCTGG + Intergenic
1111957441 13:94774674-94774696 TTATGTTAGTGAAAGTGTGAAGG - Intergenic
1113305560 13:109074692-109074714 ATCTGATGGTGTAAGTGTGCTGG - Intronic
1113896097 13:113765467-113765489 ATGTGTAAGTGCGTGTGTGCAGG - Intronic
1114811516 14:25905835-25905857 ATGAGCTAGTGGAAAAGTGCTGG - Intergenic
1115157254 14:30355521-30355543 ATGTGTGAGTGTGAGTGTGTGGG - Intergenic
1116611362 14:47076932-47076954 ATGGGTGAGTAGAAATGTGCAGG - Intronic
1120333013 14:83117588-83117610 ATGTGTAATTTGAAGAGTGCTGG + Intergenic
1120515468 14:85464969-85464991 ATGTGCTAGTTTAAGTCTGCAGG + Intergenic
1121605896 14:95239523-95239545 ATGTTTTTGTGAAAGTGTTCCGG + Intronic
1122531449 14:102430442-102430464 ATGTGTTAGGGGCAGACTGCAGG - Intronic
1123123714 14:105929890-105929912 GTGTGTCAGTGGCTGTGTGCAGG + Intronic
1123406347 15:20021381-20021403 ATGTGTCAGTGGCTGTGTGCAGG + Intergenic
1123515677 15:21028029-21028051 ATGTGTCAGTGGCTGTGTGCAGG + Intergenic
1125196239 15:37050174-37050196 ATCTGTTTGTGGAAGTATTCTGG - Intronic
1125797530 15:42414519-42414541 CTGTGTGTGTGCAAGTGTGCAGG - Exonic
1127632039 15:60836590-60836612 ACGTGTGGGTGGAAGTGTTCAGG - Intronic
1127977861 15:64011526-64011548 AAGTGTTTGTGGAAGTGTTTAGG + Intronic
1129743373 15:78001091-78001113 GTGTGTTTGGGGAAGTGTGGAGG - Intronic
1131144979 15:90004844-90004866 ATGTGTTACAGAAACTGTGCTGG + Intronic
1144040858 17:11410015-11410037 TTGTGTTAATGGAAGAGTTCAGG + Intronic
1146040008 17:29443131-29443153 ATCTGTTAGTCAAAGTGTTCAGG - Intronic
1147766850 17:42842692-42842714 TTGTGTATGTGGAAATGTGCTGG + Exonic
1148853097 17:50564279-50564301 ATGTGTTCCTGCAAGTGTGAGGG + Intronic
1149378411 17:56068615-56068637 AAGAGTTTGTGGAATTGTGCTGG - Intergenic
1152733490 17:81985227-81985249 ATGTGTGTGTGGGTGTGTGCGGG - Intronic
1153036754 18:770794-770816 GTGTGTTTGTGGAGGTGTGGGGG + Intronic
1156581361 18:38380448-38380470 ATTGATTAGTGGAAGAGTGCAGG - Intergenic
1158822150 18:61172800-61172822 ATATGTTAATGGAAGTCTGTGGG - Intergenic
1160597444 18:79986589-79986611 ATGTGTTAATGTAAGTGTTTAGG - Intronic
1160603964 18:80034823-80034845 TTGTGTTCGTGGACGTGTGTCGG + Intronic
1161442624 19:4300903-4300925 ATGTTTTAATGTAAGTGTGATGG + Intronic
1161696720 19:5772829-5772851 ATGTGTTACTGGAGGTGAACGGG + Exonic
1167058457 19:47128331-47128353 ATTGGTTGGTTGAAGTGTGCAGG + Intronic
1168482486 19:56733400-56733422 CTGTGTTAGGGAAAGTGTGGGGG + Intergenic
925818276 2:7774505-7774527 GCTTCTTAGTGGAAGTGTGCTGG - Intergenic
926591705 2:14747125-14747147 ATGTGAGAGTGTAAGTGTGCAGG - Intergenic
927475486 2:23411302-23411324 ATGTGTCAGAGGAAGTGTTGTGG + Intronic
927475576 2:23412032-23412054 ATGTGTCAGAGGAAGTGTTGTGG + Intronic
928315480 2:30241217-30241239 GTGTGTTAGTGGATGTGCGCTGG - Intronic
929810963 2:45188928-45188950 ATGTGTTTGTGTGAGTGTGTTGG - Intergenic
931367678 2:61633155-61633177 AGATGCTCGTGGAAGTGTGCTGG + Intergenic
931841562 2:66155497-66155519 AGGTGTCAGTGGCAGTGAGCAGG + Intergenic
933683019 2:85119682-85119704 ATCTGTTAGTGTAAGTGTTCAGG + Intergenic
934014191 2:87861015-87861037 ATGTGTGAGTGTCAGTGTGTGGG + Intergenic
934149050 2:89127731-89127753 CTGTGTTAGTGGTGGTGTGTTGG - Intergenic
934581464 2:95444239-95444261 ATGTGTAAGTGAAAGTGGGTGGG - Intergenic
934597986 2:95632475-95632497 ATGTGTAAGTGAAAGTGGGTGGG + Intergenic
934612432 2:95751294-95751316 CTGTTTTGGTGGGAGTGTGCTGG - Intergenic
935507257 2:103920872-103920894 ATGAGTTAATGGAAGTAGGCAGG + Intergenic
937326922 2:120995268-120995290 ATGAGTTAGTGGAGTTGGGCAGG - Intergenic
940313179 2:152300804-152300826 ATGTGTAAGTGGATATGTTCTGG + Intergenic
942982346 2:182097331-182097353 ATGTGTGAGTGTATGTGTTCAGG - Intronic
946883981 2:224204825-224204847 AAGTGTTAGCTGAAGAGTGCTGG - Intergenic
947834013 2:233162564-233162586 ATTTTTTAGTGTAAGTGTTCAGG + Intronic
948124810 2:235556826-235556848 ATGTGTTACTGGAAGTGTCTTGG + Intronic
948356105 2:237378657-237378679 ATATGTTAGTGGAGGTGTGGAGG - Exonic
1169160783 20:3376617-3376639 ATGTGTTGGTTGATGTCTGCTGG - Intronic
1169209876 20:3759950-3759972 ATGTGTGAGTGCGTGTGTGCTGG - Intronic
1171327887 20:24311724-24311746 ATGAGTTAATGGAGGTGTGTGGG - Intergenic
1173521706 20:43704838-43704860 ATGTGACAGTTGTAGTGTGCTGG - Intronic
1174047145 20:47741494-47741516 ATGTGTTAGATGATGAGTGCAGG - Intronic
1174056396 20:47801185-47801207 ATGTGTGAGTGTAGGTGTGTTGG + Intergenic
1174086635 20:48013397-48013419 AGGTGTCAGGGGAAGTTTGCTGG + Intergenic
1174100495 20:48123065-48123087 CTGTGTTAGTTGAAGTTTGAGGG - Intergenic
1174293209 20:49524025-49524047 ATGTGCAAGTGGGTGTGTGCAGG - Intronic
1175139458 20:56849247-56849269 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1175596843 20:60241452-60241474 ATGTGTAGGTGGCTGTGTGCTGG - Intergenic
1175749617 20:61486228-61486250 ATCTGTTTGTAGAACTGTGCAGG - Intronic
1176984088 21:15416135-15416157 ATGTGTCACTGCAAGTGTCCAGG + Intergenic
1180017830 21:45098685-45098707 AAGTGTTCGTGGCAGTGTGGGGG + Intronic
1181601462 22:23954240-23954262 GTGTGTGAGTGTAAGTGTGCAGG - Intergenic
1181607044 22:23987097-23987119 GTGTGTGAGTGTAAGTGTGCAGG + Intergenic
1183266797 22:36832453-36832475 ATGTTTTTGTGGAAGAGGGCTGG - Intergenic
1183602068 22:38845465-38845487 GTGTGTGCGTGGATGTGTGCTGG + Intergenic
1184638246 22:45853204-45853226 TTCTGTTAGTGAAAGTCTGCTGG - Intergenic
951829630 3:26911563-26911585 ATTTGTTCGTGTCAGTGTGCTGG - Intergenic
953867827 3:46599529-46599551 ATGTGGTAGTGGGAGCGGGCAGG - Intronic
956534938 3:70265493-70265515 GTGTGTTAGTGTGTGTGTGCAGG - Intergenic
960045222 3:113190777-113190799 ATCAGTTAGTGGAAGTGGGAAGG - Intergenic
962250878 3:133835391-133835413 GTGTGTTTGTGTAAGTGTGGGGG + Intronic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
971850019 4:31973434-31973456 ATAGGCTAGTGGAAATGTGCTGG + Intergenic
973146886 4:46838418-46838440 CTGTATTAGATGAAGTGTGCAGG + Intronic
973652752 4:53012988-53013010 ATGTAACAGTGGAAGTGTGGTGG - Intronic
976857327 4:89620175-89620197 AAATGTTAGTGTAAGTGAGCAGG - Intergenic
978735683 4:112081652-112081674 ATGTGTAATTGGAATTGGGCTGG - Intergenic
978908682 4:114040168-114040190 ATGTTTTAGTGAAAATGGGCTGG + Intergenic
979185331 4:117783553-117783575 ATGTGTTAATGGAACTGTCCAGG - Intergenic
983550957 4:169017037-169017059 ATGTGTTTGTGAGAGTGTGTAGG + Intergenic
983599195 4:169505251-169505273 GTGTGTAAGTGGATTTGTGCTGG - Intronic
984414496 4:179439518-179439540 ATTTGTTAGTGGAAATGATCTGG - Intergenic
987529962 5:19105029-19105051 ATGTGTCAGGGGAGGTGTGACGG + Intergenic
989415765 5:41173362-41173384 GTGTGTTAGTGGAAGAGTGCAGG + Intronic
989698174 5:44229361-44229383 ATGTGTTTGTGGAAGAGGGCAGG - Intergenic
994833749 5:104820814-104820836 TTGTGTTGGTGGCAGTGGGCTGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999975439 5:156907602-156907624 ATGTGTTTGTGGATATTTGCTGG - Intergenic
1000116166 5:158155425-158155447 ATGTGTTTGTGCACTTGTGCAGG - Intergenic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002339338 5:178504690-178504712 ATGTGTGAGGCGAAGTGCGCTGG + Intronic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1003469391 6:6415147-6415169 ATGTGTGAGTGTGAGTGTGCAGG - Intergenic
1003691810 6:8362271-8362293 GTCTGTAAGTGGAAGTGTGATGG - Intergenic
1004081878 6:12402977-12402999 TTGTGTTAGTGCAAGAGTGTGGG + Intergenic
1004641392 6:17519325-17519347 ACGTGTGTGTGCAAGTGTGCCGG + Intronic
1005722135 6:28613877-28613899 ATGGTTTAGTGGAAGTGGGAGGG - Intronic
1007484648 6:42172625-42172647 ATGTGTGAGTGTGAGAGTGCAGG - Intronic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1008860110 6:56138831-56138853 ATGTGGTAGAGGAAGTGGGGAGG + Intronic
1009552354 6:65115121-65115143 ATGTATTTGTGGAAGTTTGCAGG - Intronic
1012206095 6:96462401-96462423 ATGTGTCAGTGTCAGTGTGAGGG - Intergenic
1014032531 6:116722178-116722200 ATGTGTTAGCAGACGTGTGTTGG + Exonic
1015102856 6:129501690-129501712 ATGTGTTGGTGAGAGTGTGCAGG + Intronic
1015608801 6:134991260-134991282 GTGTGTAAGAGGAAGTGTGTAGG - Intronic
1015778714 6:136841425-136841447 ATGTGTTTGAGGAAGTTTTCTGG + Intronic
1017288620 6:152708791-152708813 ATGTTTTAGTGTAGGTGTGCTGG + Intronic
1019129598 6:169864172-169864194 ATGTGTTTGTGCAGGTGTGCAGG - Intergenic
1019715849 7:2538964-2538986 ATGTCTAAGTGGAGGGGTGCTGG + Intronic
1022383374 7:29881387-29881409 ATGTGTGAATGGTAGTGTGGTGG + Intronic
1024049705 7:45610762-45610784 AGGTGATAGTGGAGGTGTGGGGG + Intronic
1024049721 7:45610822-45610844 AGGTGATAGTGGAGGTGTGGAGG + Intronic
1024049757 7:45610981-45611003 GGGTGATAGTGGAAGTGTGGAGG + Intronic
1024049774 7:45611061-45611083 AGGTGATAGTGGAGGTGTGGGGG + Intronic
1025236600 7:57238973-57238995 ATGTGTGAGTGTAGGTGTGTTGG - Intergenic
1027195163 7:76025070-76025092 AGGTGAGAGTGGAAGTGTACTGG + Intronic
1029018801 7:97342280-97342302 ATGTGACAGTGGAGGTGTGGGGG - Intergenic
1029504244 7:100952610-100952632 ATGTATTAGTGGCTGTGGGCTGG - Exonic
1030508295 7:110452345-110452367 CTGTGTTAGTTGAAGTGTAGGGG - Intergenic
1034946423 7:155265218-155265240 ATGTGTGAATGGATGTGTCCTGG - Intergenic
1035010295 7:155709814-155709836 GTGTGCTAGTGGATGTGAGCTGG + Intronic
1035647831 8:1242234-1242256 ATGTGTTTGTGGAAGAGGGGAGG + Intergenic
1040703327 8:50094109-50094131 ATGTGTGTTTGGGAGTGTGCAGG + Intronic
1042617652 8:70668333-70668355 CTGTTTTAGTGGAATTATGCAGG - Intronic
1042714251 8:71755322-71755344 ATGTGTTGGTGTATGTGTGTGGG + Intergenic
1042963198 8:74324014-74324036 ATGTGTTAGTGTAAGTGTTCAGG + Intronic
1043856998 8:85275316-85275338 CCCTGTTACTGGAAGTGTGCAGG + Intronic
1044550072 8:93502225-93502247 AAGTGTTAGTTGAAGTTTGTGGG - Intergenic
1044721241 8:95150188-95150210 ATGTGTTTGTGTGTGTGTGCAGG + Intronic
1046885834 8:119366105-119366127 AAATCTTAGTGGAAGTGAGCAGG - Intergenic
1048441227 8:134460440-134460462 TTGTGTCTGTGGGAGTGTGCGGG + Intergenic
1049130843 8:140839132-140839154 TTGTGTTAGTGTGTGTGTGCTGG - Intronic
1050365038 9:4866185-4866207 CTGTGTTAGTAGCATTGTGCTGG + Intronic
1050922297 9:11219302-11219324 ATGTTTTAGTGGGAAAGTGCAGG + Intergenic
1051197362 9:14577209-14577231 AGGTGTCAGTGGTAGTGGGCAGG - Intergenic
1051774749 9:20621730-20621752 GTGTGTGAGCCGAAGTGTGCGGG - Intronic
1052133650 9:24883363-24883385 ATGTGTTTCTGTAAGTGTGTGGG + Intergenic
1052595991 9:30558985-30559007 AAGTGTTGGTGGAAGTTTGCTGG + Intergenic
1052631354 9:31044941-31044963 GTGTGTTTATGGAAGGGTGCAGG + Intergenic
1052835874 9:33249551-33249573 TTGTGTGAGTGCATGTGTGCAGG - Intronic
1053189565 9:36050905-36050927 ATGTGTGTGTGGAAGTGAGTGGG - Intronic
1057827614 9:98382866-98382888 TAGTTTTAGTGGAAGTGTGAAGG - Intronic
1058533031 9:105925633-105925655 ATGTGGTGGTTGGAGTGTGCTGG + Intergenic
1059584995 9:115596407-115596429 TTGTGCTAGAGGAAGCGTGCTGG - Intergenic
1060687816 9:125627572-125627594 AAGAGTTAGGTGAAGTGTGCTGG - Intronic
1185754145 X:2639905-2639927 ATGTGTTTGTGTATGTGTGTAGG - Intergenic
1189277066 X:39794523-39794545 ATCTGTTAGCGGTGGTGTGCTGG - Intergenic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1196873079 X:120131118-120131140 ATGTGTGAGTGAATGAGTGCAGG + Intergenic
1198749059 X:139920568-139920590 TTGAGGTAGTGGAAATGTGCTGG + Intronic
1199130281 X:144177457-144177479 ATGTGTGAGTGTCAGTGTGTGGG - Intergenic
1199730741 X:150629784-150629806 ATGAGGTAGCTGAAGTGTGCCGG - Intronic
1200052219 X:153440198-153440220 ATGTGTGTGTGCAAGTGTGGGGG + Intergenic