ID: 1070097976

View in Genome Browser
Species Human (GRCh38)
Location 10:73356920-73356942
Sequence TGGCACTGTGATGGGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070097972_1070097976 20 Left 1070097972 10:73356877-73356899 CCTGCTTTTGTCAGAATTGCTCA 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1070097976 10:73356920-73356942 TGGCACTGTGATGGGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070097976 Original CRISPR TGGCACTGTGATGGGTGCTG AGG Intronic
No off target data available for this crispr