ID: 1070104866

View in Genome Browser
Species Human (GRCh38)
Location 10:73421996-73422018
Sequence ATAAGATGATAGGAGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070104866_1070104870 20 Left 1070104866 10:73421996-73422018 CCACAATACTCCTATCATCTTAT No data
Right 1070104870 10:73422039-73422061 TAATTTATACTAATCCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070104866 Original CRISPR ATAAGATGATAGGAGTATTG TGG (reversed) Intergenic
No off target data available for this crispr