ID: 1070105170

View in Genome Browser
Species Human (GRCh38)
Location 10:73424861-73424883
Sequence CCTTAGGCAATTTGGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070105170_1070105179 -8 Left 1070105170 10:73424861-73424883 CCCATCCCCCAAATTGCCTAAGG 0: 1
1: 0
2: 1
3: 4
4: 143
Right 1070105179 10:73424876-73424898 GCCTAAGGCTGGACTAGGCAAGG 0: 1
1: 0
2: 1
3: 8
4: 166
1070105170_1070105181 -7 Left 1070105170 10:73424861-73424883 CCCATCCCCCAAATTGCCTAAGG 0: 1
1: 0
2: 1
3: 4
4: 143
Right 1070105181 10:73424877-73424899 CCTAAGGCTGGACTAGGCAAGGG 0: 1
1: 0
2: 2
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070105170 Original CRISPR CCTTAGGCAATTTGGGGGAT GGG (reversed) Intronic
901288978 1:8107308-8107330 ACATAGGAATTTTGGGGGATGGG - Intergenic
903888239 1:26553605-26553627 TCTTGGGCAATCTGAGGGATGGG + Intronic
905431519 1:37927989-37928011 GCCCAGGCATTTTGGGGGATAGG - Intronic
907442302 1:54486724-54486746 CCTCAGACAATTTGGGGAGTGGG - Intergenic
907692175 1:56680140-56680162 CCTCAGACAATGTGGGGGTTAGG - Intronic
908510562 1:64847282-64847304 CCTTAGGAAAGGTGGGGGTTGGG + Intronic
908954556 1:69606744-69606766 CCTTGAGCAATATGGGGGAGGGG + Intronic
913586540 1:120280116-120280138 TCTTAGGTAATTTGAGGGAAAGG + Intergenic
913621646 1:120618254-120618276 TCTTAGGTAATTTGAGGGAAAGG - Intergenic
914568551 1:148891978-148892000 TCTTAGGTAATTTGAGGGAAAGG + Intronic
914604274 1:149238273-149238295 TCTTAGGTAATTTGAGGGAAAGG - Intergenic
916310866 1:163397535-163397557 CCTTAAGCAATTTTGGGGGGTGG - Intergenic
917876398 1:179290860-179290882 CCTTAAGCAATTGAGAGGATGGG - Intergenic
918008259 1:180562245-180562267 ACTCAGGCATTTTGGGGGAGAGG + Intergenic
920869718 1:209783976-209783998 CCGTAGGGAATTTGGGGCAGAGG + Intronic
922346139 1:224698055-224698077 CCTTAAGCAATTTGGGGCATTGG + Intronic
923001910 1:230013127-230013149 CATTGGGCAATTTGGGGTAGAGG - Intergenic
1063523315 10:6760579-6760601 TTCTAGGCTATTTGGGGGATTGG + Intergenic
1063966431 10:11349898-11349920 CCTCAGGCAGTAGGGGGGATAGG + Intergenic
1064552503 10:16519068-16519090 CCTTAAGCTATTTGTAGGATAGG + Intronic
1064831120 10:19467564-19467586 ACTTAGGAATTTTGGGGGAAAGG + Intronic
1066362102 10:34741120-34741142 CCATAGGCAATTTGTAGGTTTGG - Intronic
1066648750 10:37636143-37636165 CCTTAAACAATGTGGGGGCTAGG + Intergenic
1067031635 10:42881833-42881855 CCTTAAACAATGTGGGGGCTAGG + Intergenic
1067699123 10:48555928-48555950 CCTGAGGCAACATGGGGGAAAGG + Intronic
1067825295 10:49567658-49567680 CCTTGAGCAATTTTGGGGGTGGG + Intergenic
1068866223 10:61897942-61897964 TCTTTTGCAATTTGGGGGAGGGG + Intergenic
1069863735 10:71487290-71487312 CCTTGAGCAATGTGGGGGTTAGG + Intronic
1069910048 10:71753491-71753513 TATTAGGCAATGTAGGGGATAGG - Intronic
1070105170 10:73424861-73424883 CCTTAGGCAATTTGGGGGATGGG - Intronic
1070377211 10:75844303-75844325 CATTAGGCTATTTGGAGGACAGG + Intronic
1072458706 10:95600180-95600202 TCATAGGCAACTTGGGGGAGGGG + Intergenic
1079000069 11:16745290-16745312 CCTTGAGCAATGTGGGGGTTAGG + Intronic
1083235147 11:61346339-61346361 GCTTCGGCACTCTGGGGGATGGG - Exonic
1083786297 11:64949958-64949980 CCATAGGCAGTTTGGAGGGTAGG - Intronic
1084278605 11:68070968-68070990 CTTAAGGGAATTTGGGGCATTGG - Intronic
1085139027 11:74123102-74123124 CCCAAGGCAATTTCTGGGATGGG - Exonic
1086620251 11:88878948-88878970 GTTTAGGCAATTTGGCGGAGGGG + Intronic
1087319316 11:96639119-96639141 CCTCAAGCAATTTGGGTGACAGG - Intergenic
1088211000 11:107456184-107456206 CCTGAGGCATTTTTGGGGCTGGG - Intronic
1089437970 11:118487501-118487523 ACTTAGGGAATTTGGGTGAGGGG - Intronic
1090215228 11:124956120-124956142 CCTTAGGAAATTTTGGAGAAGGG + Intronic
1092015762 12:5156869-5156891 CCTTTGGTAATTTGGGGTAAGGG + Intergenic
1095094011 12:38135205-38135227 CTTTTGGCAATTTTGGGTATTGG - Intergenic
1096101157 12:48971185-48971207 AGTTAGGCAAGGTGGGGGATAGG - Intronic
1096422316 12:51469608-51469630 CCACAGGCTATTTGGGGGCTTGG + Exonic
1096709990 12:53448369-53448391 CCTAATACAATTTGGGGGGTGGG + Intergenic
1100583929 12:95961892-95961914 CCTTTACCCATTTGGGGGATTGG + Intronic
1102293035 12:111716369-111716391 CATTTGGCTTTTTGGGGGATTGG - Intronic
1105459627 13:20571434-20571456 TTTTAGGCAATTTGAGGGGTGGG - Intronic
1106954011 13:34915643-34915665 CTTTCTGCAATCTGGGGGATGGG - Intergenic
1109281362 13:60359723-60359745 TCTTAAGCAACTTGGGGCATGGG + Intergenic
1109979960 13:69894819-69894841 CCTATGCCAATTTGGAGGATTGG - Intronic
1113273268 13:108698814-108698836 GCTTAGTCAATTTTGGGGACAGG - Intronic
1114204248 14:20553750-20553772 CCATAGGGAATCTGGTGGATAGG + Intergenic
1116077443 14:40128914-40128936 GCATAGGGAATTCGGGGGATGGG - Intergenic
1116410726 14:44619932-44619954 GCTTAGGAAATCTGGGGGAAAGG - Intergenic
1118327341 14:64790669-64790691 CCTGAGGCAATCTGGGAGGTGGG - Intronic
1120543062 14:85775306-85775328 CCTTATGCAGTTTGGTGGAGTGG - Intergenic
1124579662 15:30942314-30942336 CCTTAAGCAAATTAGTGGATAGG - Exonic
1125311236 15:38380116-38380138 CCTTAGAATATTTGGGGGAGTGG - Intergenic
1125908560 15:43415793-43415815 CCATAGACAATTTGGTGGAAGGG - Exonic
1127185696 15:56477873-56477895 TCTTAGTTATTTTGGGGGATGGG + Intergenic
1137726932 16:50662986-50663008 CCTTAGGGAATCTGGGGCTTTGG + Intergenic
1137783193 16:51114961-51114983 GCTTATGCAATTTGGAGGAGAGG + Intergenic
1143263995 17:5622011-5622033 GTTTATGCATTTTGGGGGATGGG + Intergenic
1147881416 17:43656481-43656503 CCTTAGGCAAATTTGTGGTTGGG + Intronic
1149017377 17:51924199-51924221 CCTTAGGCAAGTGGGGTGAAGGG + Intronic
1149266636 17:54934225-54934247 TCTTAGGCAAATTGTGGGAGAGG + Intronic
1151189522 17:72388115-72388137 CCTTACACACTTAGGGGGATGGG - Intergenic
1158499157 18:57984382-57984404 CACTAGGCAATTTGGGGCTTAGG + Intergenic
1165187675 19:34036030-34036052 CCTTAGGCAATTCCTGGGCTTGG - Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1166759118 19:45213446-45213468 ACTCAGGCAATTTCTGGGATAGG - Intronic
1168441286 19:56369346-56369368 CCTTTGGAAATTTTGGGGAATGG + Intergenic
928660516 2:33497514-33497536 CCTAAAACAATTTGGGGGAGTGG - Intronic
928874318 2:36018988-36019010 CCTTAGGAAATTTGGGAGAATGG + Intergenic
931387366 2:61809591-61809613 CCGTAGGGAATTTGGGGGTTGGG + Intergenic
934957774 2:98638009-98638031 CCTTGGGCAAGTGGGGTGATGGG + Intronic
936004219 2:108867740-108867762 CCTTATCCAGTTTGAGGGATGGG + Intronic
936735964 2:115444022-115444044 CCTGGGGCAATGTGGGGGAGGGG - Intronic
937416356 2:121718091-121718113 CCTTAAGCAATTTGGTGCTTAGG - Intergenic
937839375 2:126510472-126510494 GCTGGGGCAATGTGGGGGATGGG + Intergenic
938792965 2:134692899-134692921 ACTGAGGCAATGTGGTGGATGGG - Intronic
938841350 2:135167755-135167777 CCTTATGAAATTAGAGGGATGGG - Intronic
940520885 2:154746343-154746365 CCTTAAACAATGTGGGGGCTAGG - Intronic
942505178 2:176634455-176634477 CCCTAGGTAGTTTTGGGGATTGG - Intergenic
943710321 2:191086564-191086586 CTTTAGTAAAATTGGGGGATTGG + Intronic
945375070 2:209070187-209070209 CCTTAGGAAATTTTGAGGTTAGG - Intergenic
1169052036 20:2587895-2587917 ACTTAGGGAATTGGGGAGATTGG - Intronic
1169509494 20:6248382-6248404 CCTTAAACAATTTGGGGATTAGG - Intergenic
1174855652 20:54042832-54042854 CCCTAGGCAAATTGGGAAATAGG - Intronic
1175464689 20:59182668-59182690 GCTTAGGCAAGTTGGAGGAGAGG - Intergenic
1175666347 20:60863517-60863539 CATTAGGCAATTGAAGGGATTGG + Intergenic
950063717 3:10093869-10093891 CCTTGCGCAATGTGGGAGATGGG + Intronic
950339678 3:12231539-12231561 ACATAGGCATTTTGGGGGGTGGG + Intergenic
952052146 3:29397430-29397452 CCAAGGCCAATTTGGGGGATCGG - Intronic
955422289 3:58750676-58750698 CTTTAGGCAAATTGAGGGGTTGG + Intronic
963951537 3:151207509-151207531 TGTCAGGCAATTTGGGGGCTTGG + Intronic
964650621 3:159007615-159007637 CCTTGGGAAATTTGGGGAAGAGG + Intronic
966368121 3:179213009-179213031 CCTTGGACAATATAGGGGATAGG - Intronic
969922402 4:10552672-10552694 CCAAAGGCAGTTTGGGGGAAGGG - Intronic
970238996 4:13988665-13988687 CCTTATGCAATCTAGGAGATGGG - Intergenic
974378747 4:61110306-61110328 CCATAGTCAATTTGAGTGATTGG - Intergenic
974863679 4:67553776-67553798 CCTTAGGGAATAAGGTGGATTGG - Intergenic
975100536 4:70508061-70508083 CCTTGGGCAACTGGGTGGATGGG + Intergenic
981588396 4:146328655-146328677 GGTGAGGCATTTTGGGGGATAGG - Intronic
981865570 4:149414333-149414355 CCTGAGGTAATTTGAGGCATCGG - Intergenic
986363797 5:7008890-7008912 TGCTAGGCACTTTGGGGGATGGG + Intergenic
987234592 5:15929864-15929886 CCTCAGGGAGTTTGGGGGAGGGG + Intronic
989146479 5:38256031-38256053 CCATAGGCGATTTGGGAAATAGG - Intergenic
990534065 5:56702718-56702740 CCTGAGTGCATTTGGGGGATTGG - Intergenic
991654966 5:68894789-68894811 CCTTAGGCAATCTGTGGGTGAGG + Intergenic
997339452 5:133131371-133131393 ACTTAGCCACTTTGGGGGATGGG + Intergenic
998651363 5:144124824-144124846 CCTTAGGCAAATTTAGGGAAAGG + Intergenic
998933480 5:147207432-147207454 AATTTTGCAATTTGGGGGATTGG + Intergenic
999342229 5:150782126-150782148 CCTTAGGGACTTTGGGTCATTGG + Intronic
1000581980 5:163046382-163046404 CCTTATGCAGTTTGTGTGATAGG + Intergenic
1001064622 5:168526533-168526555 CCTTGGGCAATTTGTTGGAATGG + Intergenic
1008148047 6:47916089-47916111 CCTTCAGCACTTTGTGGGATTGG - Intronic
1008405475 6:51114165-51114187 TCAAAGGCAATTTGGGGGAAGGG + Intergenic
1008722754 6:54376950-54376972 CCTTAGGGAATGTGGTAGATGGG + Intronic
1010025101 6:71205974-71205996 CCTTAGGCTTTTTTGGGGAGGGG - Intergenic
1011258485 6:85448747-85448769 CATAAGGCAATATGGGTGATGGG + Intergenic
1012914217 6:105151208-105151230 CCTTGGGTATTGTGGGGGATTGG + Intergenic
1014297209 6:119634018-119634040 TCTTAAACAATTTGGGGGTTAGG - Intergenic
1017292843 6:152761405-152761427 CCTGAGGCAACTTGAAGGATGGG + Intergenic
1018687162 6:166312273-166312295 CCCTAAGCAATGTGGGGGTTAGG - Intergenic
1023069429 7:36414322-36414344 CCTAAGTCAATTTGTGTGATGGG + Intronic
1031108625 7:117577706-117577728 CCTTGGACAATGTGGGGGTTAGG + Intronic
1031450735 7:121914943-121914965 CCGTAAGTAATTTGGGGGACTGG + Intronic
1032997175 7:137460108-137460130 CCCCAGTCAACTTGGGGGATAGG - Intronic
1040052027 8:43024824-43024846 ACTTCGGTAATTTGAGGGATTGG - Exonic
1043309422 8:78839621-78839643 CCTTTGCCAATTTGAGAGATTGG + Intergenic
1048684944 8:136894283-136894305 CCTTGGACAACTTGGGGGTTAGG - Intergenic
1048792365 8:138115547-138115569 CCTGAGGCAAATTGTGGAATTGG + Intergenic
1053394368 9:37759460-37759482 CCTTTGGCAAGTTGTGGGAATGG + Intronic
1058343245 9:103923755-103923777 ACTTTGGGAATTTGGGGGAAAGG + Intergenic
1058599549 9:106654252-106654274 CCTTACTCCATTTGGGGGCTGGG + Intergenic
1059332486 9:113544400-113544422 CTTTTGGCTATTTGGGGGTTGGG + Intronic
1059508675 9:114823521-114823543 TCTTAGGTGATCTGGGGGATGGG + Intergenic
1060579513 9:124731920-124731942 CCTTAAACAATGTGGGGGTTAGG - Intronic
1187419283 X:19121523-19121545 CCTTAGGAAAAGTGGGAGATTGG - Intronic
1194350765 X:92823152-92823174 CTTGAGGCAGGTTGGGGGATTGG + Intergenic
1195031889 X:100934306-100934328 GCTTATGCAATTTAGGGGACTGG + Intergenic
1196659437 X:118254072-118254094 CCTTAAGAAATTTTGGGGCTGGG + Intergenic
1200813497 Y:7507929-7507951 CATTATGGGATTTGGGGGATAGG + Intergenic
1201409483 Y:13684689-13684711 GCTTAAGCAGTTTGGGGGCTGGG - Intergenic
1201497427 Y:14603534-14603556 GTTTAAGCAATTTGGGGGATTGG + Intronic