ID: 1070106488

View in Genome Browser
Species Human (GRCh38)
Location 10:73437074-73437096
Sequence AACTGCTTGGTTAAACTAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070106488_1070106490 -2 Left 1070106488 10:73437074-73437096 CCATTTAGTTTAACCAAGCAGTT 0: 1
1: 0
2: 2
3: 10
4: 145
Right 1070106490 10:73437095-73437117 TTCAGTAACTATCAAAAGAAAGG 0: 1
1: 0
2: 3
3: 37
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070106488 Original CRISPR AACTGCTTGGTTAAACTAAA TGG (reversed) Exonic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905727237 1:40263397-40263419 AAAGGCTTGGATAAATTAAAGGG + Intronic
907791982 1:57675764-57675786 AAATGCCTGTTTAAAATAAAAGG - Intronic
907950920 1:59182828-59182850 AACCACTTGGTTAAACTGCATGG + Intergenic
908333011 1:63089577-63089599 AACTGTTTGGAGAAACTGAAAGG + Intergenic
908468832 1:64422120-64422142 CACTGCTAGTTTGAACTAAAGGG - Intergenic
911933606 1:103937282-103937304 AACTGCTTGGCTAAATAAAAGGG - Intergenic
917311881 1:173687377-173687399 AACTGGTTGTTTAAATAAAAGGG - Intergenic
918033036 1:180835501-180835523 AACTGCTGGCATAAACTAAGGGG - Intronic
919875574 1:201864281-201864303 AACTGCCTGTTTTAATTAAATGG + Intronic
923426673 1:233877037-233877059 CACTGTGTGGTTAAAGTAAACGG + Intergenic
924854542 1:247863211-247863233 AACTTCTTGCTTTGACTAAAAGG - Intronic
1063532220 10:6844643-6844665 AACTTTTTGATTAAACTAATAGG - Intergenic
1067022795 10:42816395-42816417 ATCTGTTTAGGTAAACTAAATGG - Intronic
1069396930 10:67999788-67999810 CTCTGCTTGAGTAAACTAAAAGG + Intronic
1069780929 10:70954905-70954927 AACTGCTTTATTCAACTAATGGG + Intergenic
1070106488 10:73437074-73437096 AACTGCTTGGTTAAACTAAATGG - Exonic
1071480082 10:86058474-86058496 AACTGGCTGATTAAACTAAAAGG + Intronic
1072514205 10:96162257-96162279 AACTGGTTGTTTAATTTAAAAGG + Exonic
1077878275 11:6325927-6325949 AACTGCTTTAAAAAACTAAAAGG + Intergenic
1078870995 11:15344706-15344728 AAATGCTGAGTTAAATTAAAAGG + Intergenic
1079218012 11:18532189-18532211 AACTGCTTGGTTAAAGTAGAGGG - Exonic
1080042126 11:27769949-27769971 AACTACTTGGTTAAACTTTTTGG + Intergenic
1080471436 11:32549570-32549592 AATTGCTTTGCTAAACTTAAAGG + Intergenic
1082310758 11:50645132-50645154 AACTGCTGGATTAAAAGAAAGGG - Intergenic
1087279442 11:96193775-96193797 GACTGTTTGGCTAAAGTAAATGG - Intronic
1087289899 11:96309283-96309305 AACTATAGGGTTAAACTAAAGGG - Intronic
1087762839 11:102120656-102120678 AATTGATTGCTTAACCTAAAGGG + Intronic
1087879574 11:103399851-103399873 AAGTGCTTTATTAAACCAAAAGG + Exonic
1091826732 12:3518435-3518457 AGCTGCTTTGTTAAACTGAGGGG - Intronic
1094527386 12:31240880-31240902 AATTACTTGGTAAAACTAAATGG + Intergenic
1098167409 12:67712414-67712436 AACTTTTGGCTTAAACTAAAAGG + Intergenic
1098247067 12:68530879-68530901 AACTGCTTGGGGAACCTAATAGG + Intergenic
1099903621 12:88744930-88744952 AACAGCTTTGCTAAGCTAAAAGG - Intergenic
1101001753 12:100363954-100363976 AATTGCTTGATTAAACCCAAGGG + Intronic
1103866432 12:124055630-124055652 AAATGGTTTGTTAAACAAAATGG + Intronic
1104375486 12:128262505-128262527 CAGTGCTTGTTTAAAATAAAAGG + Intergenic
1104516139 12:129428944-129428966 AACTGCTTAGTGCAACTAAGTGG - Intronic
1105119059 13:16747831-16747853 AACTGCTCTGTAAAAATAAAAGG - Intergenic
1107498654 13:40954225-40954247 AAATGCTTTGTTAAAAAAAAGGG + Intronic
1109706319 13:66097048-66097070 AAATGCTTAGTAAACCTAAAAGG + Intergenic
1112756098 13:102635251-102635273 CACTGCTGGGTTAAACAAGATGG - Intronic
1116745746 14:48816606-48816628 AACTGACTGGTTCAACTGAAGGG + Intergenic
1118365531 14:65092352-65092374 AATTGCTTTGGTAAACTATATGG - Intronic
1122528003 14:102402940-102402962 AAATGCTTGGTTAAATTCACTGG - Intronic
1123423949 15:20153573-20153595 ATCTGTTTAGGTAAACTAAATGG - Intergenic
1123533170 15:21160102-21160124 ATCTGTTTAGGTAAACTAAATGG - Intergenic
1125428776 15:39575939-39575961 AACTGAGTGGTTGAACTAGATGG + Intergenic
1127210849 15:56773019-56773041 AAATGCTTGAGTAAACAAAAAGG + Intronic
1131646313 15:94348887-94348909 ATTTTCTTGGTTAAACTCAAAGG + Intronic
1136860922 16:33702313-33702335 ATCTGTTTAGGTAAACTAAATGG + Intergenic
1139000547 16:62505419-62505441 CACTGCTAGTTTGAACTAAAGGG + Intergenic
1139827926 16:69772262-69772284 AACTGCTTGGTTGAACTGGGTGG + Intronic
1203122416 16_KI270728v1_random:1550497-1550519 ATCTGTTTAGGTAAACTAAATGG + Intergenic
1145924308 17:28634324-28634346 AATTGCTTGGCTAACATAAAGGG - Intronic
1152994577 18:394624-394646 AACTGCATAGTAAAACTAATGGG + Intronic
1154908082 18:20604829-20604851 AACTGCTCTGTCAAACGAAATGG - Intergenic
1154908276 18:20607888-20607910 AACTGCTCTGTCAAACGAAATGG - Intergenic
1154909306 18:20624214-20624236 AACTGCTCTGTCAAACGAAATGG - Intergenic
1154909740 18:20630801-20630823 AACTGCTCTGTCAAACGAAATGG - Intergenic
1154911850 18:20664155-20664177 AACTGCTCTGTCAAACGAAATGG - Intergenic
1154921495 18:20813356-20813378 AACTGCTCTGTCAAACGAAATGG + Intergenic
1154925419 18:20925763-20925785 AACTGCTCTGTCAAACGAAATGG - Intergenic
1156406541 18:36788034-36788056 CACTGTTGGGTTAAACTATATGG + Intronic
1160329171 18:77976881-77976903 AAATTCTTGGTTCAACAAAAAGG - Intergenic
1162011316 19:7817098-7817120 AACTGGTTGTAGAAACTAAATGG + Intergenic
925666413 2:6261646-6261668 AACAGCTTGGAGAAAATAAATGG - Intergenic
931223105 2:60306075-60306097 AACACCTTGGTTAAAAAAAAAGG - Intergenic
934488018 2:94736160-94736182 AACAGCCTCGTTAAACTAATTGG - Intergenic
934960425 2:98668150-98668172 AACTGAATGGTTAAGCTCAATGG + Intronic
935105138 2:100035614-100035636 AAATGCTTAAGTAAACTAAAAGG - Intronic
935302912 2:101709073-101709095 AAGTGTTTGGTTACACTAAAGGG - Intronic
936596524 2:113853442-113853464 AACTGCATTGGAAAACTAAAGGG - Intergenic
938817926 2:134923440-134923462 TATTGCTTTATTAAACTAAAAGG - Intronic
940335118 2:152518676-152518698 AACTGACTGGTTAGACTTAAGGG - Intronic
940619891 2:156098597-156098619 CTCTGCTTGCTTAAACTAACAGG + Intergenic
940968310 2:159865365-159865387 AAATGCTTGTTTAAACTTAGTGG - Intronic
941581126 2:167296003-167296025 AACTGCTTGTATAAATTAAGTGG - Intergenic
941920086 2:170841581-170841603 AACTGCTTTGGTGAACTACAAGG + Intronic
942087495 2:172456908-172456930 AACACCTTGGCTAATCTAAAAGG + Intronic
943114685 2:183653323-183653345 AACTACATGGTTAATCAAAAAGG - Intergenic
944334345 2:198513209-198513231 AACTGCTTTGGAAAACTAATTGG - Intronic
945518620 2:210795553-210795575 AACTGCTCAGTTGAGCTAAAAGG + Intergenic
947360340 2:229339916-229339938 AACTGTCTGGTTAAAATATAAGG - Intergenic
948157856 2:235799031-235799053 AAGGGGTTGGTTAAACTAAAGGG - Intronic
1171765416 20:29265469-29265491 AACTGCTCAGTTAAAAAAAAAGG - Intergenic
1172510614 20:35498312-35498334 AACTCCTTGGTGAAATTATAAGG - Intronic
1173883997 20:46440723-46440745 AAATGGTTGGTTAAACGAAGTGG + Intergenic
1181356912 22:22303020-22303042 ATCTGTTTAGGTAAACTAAATGG - Intergenic
949297424 3:2541917-2541939 AACTGAGTTGTGAAACTAAAAGG + Intronic
950329959 3:12148331-12148353 AGCTGCTTTGTGAAACTGAAGGG - Intronic
954923280 3:54210318-54210340 AACTGTTTGATTAAACTTACTGG - Intronic
954998644 3:54905807-54905829 AACTGTTGGGTTAAACTGACAGG + Intronic
957155985 3:76544888-76544910 AACTGCTTGAGTCAACAAAAGGG - Intronic
970710831 4:18860128-18860150 AATTGCTTTGTTAAAAAAAAGGG + Intergenic
972490892 4:39586045-39586067 AACTGCCAGGTTGAACTAAAAGG - Intronic
974420701 4:61669654-61669676 AACTTCTTGGGTATACTAAGTGG + Intronic
974856642 4:67468859-67468881 AACTGCTTGGATGATCTTAAGGG + Intergenic
975192397 4:71480343-71480365 AAATACTTGGGAAAACTAAAAGG + Intronic
975379956 4:73688374-73688396 AACTAATTAATTAAACTAAATGG + Intergenic
979090371 4:116476559-116476581 AATTACTTAATTAAACTAAAGGG + Intergenic
979209586 4:118083278-118083300 AAATCCTTTCTTAAACTAAATGG + Intronic
981079004 4:140619695-140619717 AGCTACTTGATTAAACCAAATGG + Intergenic
981122235 4:141065496-141065518 AACTGCTTAGTTAACTTAAGAGG + Intronic
981965168 4:150591576-150591598 CTCTGCATGTTTAAACTAAAGGG + Intronic
982844371 4:160231481-160231503 AACTTCTGGATTAAAGTAAATGG + Intergenic
983429752 4:167633515-167633537 AACTTCTAGAATAAACTAAAAGG + Intergenic
984929284 4:184832416-184832438 AAGTGCATGTTAAAACTAAAAGG - Intergenic
985100775 4:186456278-186456300 ATCTGCTTGGTTATACGAAGGGG + Intronic
988026012 5:25690867-25690889 CACTGCATTGTTAAACTGAAAGG - Intergenic
989846144 5:46144735-46144757 AACTGCTTAATCAAAATAAATGG - Intergenic
990916931 5:60917061-60917083 AACTGCATGATAGAACTAAAAGG + Intronic
990937721 5:61167970-61167992 AAATGCTTGTTTAAATTAGAAGG + Intergenic
992253923 5:74902742-74902764 AACAACCTGGTTAAAATAAATGG + Intergenic
992938203 5:81734027-81734049 AACTACTTATTTAAAGTAAATGG + Intronic
995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG + Intergenic
997498132 5:134348040-134348062 AAAGGCTAGATTAAACTAAATGG + Intronic
1000206740 5:159067931-159067953 GACTGCTTGGTTAAAATAAAAGG - Intronic
1000803820 5:165762791-165762813 CACTCCTTGATTAAAATAAATGG - Intergenic
1001204980 5:169753922-169753944 CACTGCTTGGCTAAAATAAAAGG + Intronic
1002288803 5:178184301-178184323 ATCTACTTGGTTTAACTTAAAGG - Intergenic
1005766085 6:29013613-29013635 AAAAACTTTGTTAAACTAAATGG + Intergenic
1007824832 6:44592581-44592603 AACTGTTTTGCTAAACTGAAGGG - Intergenic
1010581264 6:77599268-77599290 AAATGATTGTTTAATCTAAAAGG - Intergenic
1012307500 6:97676684-97676706 AACTTTTGGATTAAACTAAAAGG + Intergenic
1012574505 6:100775795-100775817 AACTTGTTGGTAAAAATAAAAGG + Intronic
1012585510 6:100916932-100916954 AACTGCTTCTATAAACTCAAAGG + Intergenic
1014973408 6:127847571-127847593 ACCTCCTTGGTTAAAATATAAGG - Intronic
1015532397 6:134234017-134234039 AACTGCTTGGTTTCAGAAAAGGG - Intronic
1018450146 6:163900336-163900358 GACTGCATAGTTAGACTAAAAGG - Intergenic
1021095248 7:16528005-16528027 AATTAGTTGGTTAACCTAAAAGG - Intronic
1021357283 7:19667007-19667029 AAGTACTTGCTTAACCTAAATGG + Intergenic
1028138792 7:87249092-87249114 AATTGCTGGATTAAACTAAAGGG + Intergenic
1032309712 7:130773507-130773529 AACAGTTTGGTTCAACTATATGG + Intergenic
1035494816 7:159315370-159315392 GACTGCTTGGTTAAAGTGAGTGG + Intergenic
1036523421 8:9513527-9513549 AACTGTTTTGTTATTCTAAAAGG + Intergenic
1036911118 8:12757736-12757758 GACTGCTTGTTTAAATTCAAAGG + Intergenic
1039026941 8:33268670-33268692 ATCTGCTTGGTTCAAGTAACTGG + Intergenic
1039533231 8:38283608-38283630 AAATGAATGGTTAAACTAGAAGG + Intronic
1039650019 8:39331312-39331334 AACTGTTTTGTATAACTAAAGGG + Intergenic
1041406521 8:57505409-57505431 AAAGGCTTTGTTAAACAAAAAGG + Intergenic
1042984533 8:74568319-74568341 AACTCCTGGTTTAAACAAAAAGG - Intergenic
1050867663 9:10523514-10523536 ACCTGCTTGTTTATATTAAAGGG - Intronic
1053689793 9:40579252-40579274 ATCTGTTTAGGTAAACTAAATGG + Intergenic
1054301040 9:63380193-63380215 ATCTGTTTAGGTAAACTAAATGG + Intergenic
1057994256 9:99805778-99805800 AACTGATTTGTTAATGTAAATGG - Intergenic
1058646461 9:107135613-107135635 AACTGTTAGGTTAAAAAAAATGG + Intergenic
1060641057 9:125239519-125239541 AACTGCATGGGTAACCTAAAAGG + Exonic
1061756726 9:132818619-132818641 AAATACTTGGTTAATCCAAAAGG + Intronic
1185966164 X:4606533-4606555 AAATGACTGCTTAAACTAAAGGG + Intergenic
1186906106 X:14112456-14112478 AACTACTTGATTAAAAAAAAAGG + Intergenic
1187043570 X:15623133-15623155 AACTGCTTGATGAAACTGGAAGG - Intergenic
1187229540 X:17407714-17407736 AATTGCTTGGTTCAAATAAAAGG - Intronic
1187696475 X:21927171-21927193 AACAGCTTGGTAAAACTCTATGG - Intergenic
1188580199 X:31702496-31702518 ATCTTCTTGGTTAAAGTATAAGG - Intronic
1193333961 X:80265534-80265556 AAATGCTTGGATAAAAAAAAAGG + Intergenic
1198184987 X:134246228-134246250 AACTGCCTGTTCAAACTCAATGG + Intergenic
1202049671 Y:20767415-20767437 GACTGCTGGGTTATATTAAATGG + Intronic