ID: 1070112075

View in Genome Browser
Species Human (GRCh38)
Location 10:73495912-73495934
Sequence GCTCTGGGCCGGGCGGGGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 361}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070112067_1070112075 -8 Left 1070112067 10:73495897-73495919 CCGGGGCTCGGCTAGGCTCTGGG 0: 1
1: 0
2: 4
3: 33
4: 293
Right 1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG 0: 1
1: 0
2: 2
3: 31
4: 361
1070112055_1070112075 18 Left 1070112055 10:73495871-73495893 CCGGCTCCGGGGCGGCCATGCTG 0: 1
1: 0
2: 1
3: 20
4: 166
Right 1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG 0: 1
1: 0
2: 2
3: 31
4: 361
1070112063_1070112075 3 Left 1070112063 10:73495886-73495908 CCATGCTGGGCCCGGGGCTCGGC 0: 1
1: 0
2: 1
3: 42
4: 352
Right 1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG 0: 1
1: 0
2: 2
3: 31
4: 361
1070112053_1070112075 24 Left 1070112053 10:73495865-73495887 CCCGGGCCGGCTCCGGGGCGGCC 0: 1
1: 0
2: 3
3: 50
4: 498
Right 1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG 0: 1
1: 0
2: 2
3: 31
4: 361
1070112058_1070112075 12 Left 1070112058 10:73495877-73495899 CCGGGGCGGCCATGCTGGGCCCG 0: 1
1: 0
2: 5
3: 24
4: 297
Right 1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG 0: 1
1: 0
2: 2
3: 31
4: 361
1070112054_1070112075 23 Left 1070112054 10:73495866-73495888 CCGGGCCGGCTCCGGGGCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 256
Right 1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG 0: 1
1: 0
2: 2
3: 31
4: 361
1070112065_1070112075 -7 Left 1070112065 10:73495896-73495918 CCCGGGGCTCGGCTAGGCTCTGG 0: 1
1: 0
2: 1
3: 36
4: 357
Right 1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG 0: 1
1: 0
2: 2
3: 31
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070112075 Original CRISPR GCTCTGGGCCGGGCGGGGTT GGG Exonic
900129077 1:1080059-1080081 GCACGGGGCGGGGCGGGGTGGGG - Intergenic
900163205 1:1234303-1234325 GCTCGGGGCAGGGCTGGGTTAGG + Exonic
900299338 1:1969231-1969253 GGGCTGGGCAGGGCTGGGTTGGG - Intronic
900299421 1:1969466-1969488 GGGCTGGGCCGGGCAGGGCTGGG - Intronic
900324111 1:2099502-2099524 GCAGTGGGCGGGGCGGGGTGGGG + Intronic
900531026 1:3153244-3153266 GCTCTGGGCCAGGCAGGGTCTGG + Intronic
900625349 1:3605964-3605986 GCACTGTCCCGGGAGGGGTTGGG - Intronic
901016753 1:6236151-6236173 ACTCTGTGCCGGGCGGGGGCCGG + Intergenic
901051148 1:6426446-6426468 CCTCTGGGCTGGGCAGGCTTGGG + Intronic
901262705 1:7885615-7885637 GCCCAGGGCTGGGCGGGGTCTGG + Intergenic
901886956 1:12230135-12230157 GCTCCGTGCCGGGCGGGGCCAGG + Intronic
902412118 1:16217691-16217713 GCTCTGGGCCAGGTGGGCATGGG + Intergenic
902470357 1:16644604-16644626 GCTCTGAGCCTGGCGGGTTCCGG - Intergenic
902558622 1:17261815-17261837 GGTTTGGGCTGGGCAGGGTTTGG - Intronic
902829006 1:18997620-18997642 GGTGCGGGCCGGGCTGGGTTGGG - Intergenic
903222940 1:21878961-21878983 GCTCCGGGTCAGGGGGGGTTTGG - Intronic
903374075 1:22854817-22854839 CCTCTGGGCTGGGCTGGGCTGGG - Intronic
903560690 1:24224826-24224848 GATCTGGGCCTGGCGGAGCTTGG + Intergenic
904015333 1:27415552-27415574 GCTACGGGCTGGGCGGGGCTAGG - Intronic
904049715 1:27631888-27631910 GCTCTGGGCTGGCCGGGGGCAGG + Intronic
904270069 1:29344085-29344107 GTTCTGGGCCAGGCAGGGGTGGG - Intergenic
904428465 1:30446765-30446787 GTTCTGGGCCAGGCGGGGGTGGG + Intergenic
904904365 1:33883924-33883946 GAGCTGGGCAGGGCGGGGCTGGG + Intronic
905174055 1:36125293-36125315 GCGCTGGGCCGGGCGGGGCGCGG - Intergenic
905336504 1:37248249-37248271 GCGCTGGGCTGGGCTGGGCTGGG + Intergenic
905584282 1:39105165-39105187 AGTCCGGGCCGGGCGGGGGTCGG + Intronic
905690169 1:39937084-39937106 GCTCTGGGCTGGGCTGGGCTGGG - Intergenic
905865158 1:41372465-41372487 GCTCAGGGCAGGGCTGGGTGAGG + Intronic
906528826 1:46511753-46511775 GCTCTGGGCAGGGTGGGGGAGGG + Intronic
907051061 1:51330292-51330314 GCCAGGGGCCGGGCGGGGTGGGG + Intronic
907464029 1:54623419-54623441 ACTCTGGGCCGCACGGAGTTGGG - Exonic
907767287 1:57423924-57423946 GCTCTGGGCTAGGCGAGGTGAGG - Exonic
908789864 1:67770639-67770661 GCTCTGGGCCCCCCGGGATTTGG - Intronic
910854671 1:91683696-91683718 GAGCTGGGCTGGGCTGGGTTGGG + Exonic
912568612 1:110606450-110606472 GCCCTGGGGCCGGCGGGATTGGG - Intronic
913439600 1:118883829-118883851 GTAGTGGGGCGGGCGGGGTTTGG + Exonic
916078605 1:161218081-161218103 GCGCTGGGCAGGGTGGGGTAAGG + Intronic
916941396 1:169682307-169682329 GCTCTGTGGCGGGAGGGGTAGGG - Intronic
917291569 1:173477164-173477186 GGGCTGGGCCGGGCCGGGCTGGG - Intergenic
917291583 1:173477196-173477218 GCGCGGGGCGGGGCGGGGCTGGG - Intergenic
920045223 1:203128350-203128372 GCTCCGGGCCGCGCGCGGTAGGG - Intronic
920062924 1:203240158-203240180 GAACTGGGCTGGGCGGGGCTGGG + Intronic
921599178 1:217089127-217089149 GCGCTGGGAGGGGAGGGGTTAGG - Intronic
922505161 1:226121955-226121977 CCTCCGGGCCGGGCGGGGTCTGG - Intergenic
922701727 1:227765228-227765250 GCCTTGGGCAGGGCGGGGTGGGG + Intronic
1064251080 10:13706977-13706999 GCTCTCGGCCGGGCGTGTTATGG - Intronic
1066022918 10:31320095-31320117 GCTCTGGGCCGGGCAGCGGGAGG - Intronic
1067037866 10:42932890-42932912 GCTGTGGGCGGGGCGGGGCGGGG + Intergenic
1067342718 10:45418277-45418299 GCCCTGGGCCGGTGGGGGTTGGG + Intronic
1067848131 10:49738899-49738921 GATCTGGGCCAGGCTGGGTGTGG - Intronic
1069814787 10:71186895-71186917 GCTCTGGCCTGGGCGGAGGTGGG + Intergenic
1069962472 10:72087186-72087208 CCTCTCGGCCGGGCCGGGTTGGG - Intronic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1070490315 10:76969886-76969908 ACTCTGGGCCTGGCAGGGTGAGG + Intronic
1070570893 10:77638549-77638571 GCTCCGGGCTGGGCAGGGGTGGG + Intronic
1070752809 10:78973956-78973978 GGGCTGGGCCGGGCGGGGCCGGG - Intergenic
1071498754 10:86188965-86188987 GCCCTGGGCCTGGCGGAGTGGGG - Intronic
1071527432 10:86366561-86366583 GCGCTGGGCTGGGCTGGGCTGGG - Intergenic
1071600093 10:86954812-86954834 GCTCTGTGCCCGGCAGGGGTCGG + Intronic
1074268423 10:111928516-111928538 TCCCTGGGCCGGGCTGGGTAGGG - Intergenic
1075069384 10:119310686-119310708 GCCCCAGGCAGGGCGGGGTTGGG + Intronic
1075760107 10:124849190-124849212 GCTCTGGGCCCCACGGGGCTTGG + Intergenic
1076413468 10:130267965-130267987 GCTCTGGGCCTGGCCTGGCTGGG + Intergenic
1076552645 10:131293471-131293493 TCTCTGGTCGGGGAGGGGTTTGG - Intronic
1076852819 10:133101396-133101418 GCCCTGGGTCCGGCGGGGTGGGG + Intronic
1077035836 11:494137-494159 GCGCTGGGCCGCGCTGGGCTGGG + Intergenic
1077035841 11:494147-494169 GCGCTGGGCTGGGCTGGGCTGGG + Intergenic
1077105122 11:838905-838927 ACACTGGGCGGGGCGGGGGTGGG - Intronic
1077230034 11:1454646-1454668 GGGCTGGGCCGTGTGGGGTTGGG - Intronic
1079004725 11:16783611-16783633 GCCCTGGGCCGGGCTGGCTGGGG - Intronic
1081866913 11:46365209-46365231 GCTCTGGGCTGTGCAGCGTTTGG + Intronic
1083294520 11:61707865-61707887 GGGCTGGGCAGGGCGGGGTAGGG + Intronic
1083460196 11:62806046-62806068 ACTCAGGGCGGGGCGGGGTGGGG - Intronic
1083466090 11:62847203-62847225 TCTCTGGTCGGGGAGGGGTTTGG + Intergenic
1083560621 11:63670911-63670933 GCTCTGCCCAGGGCGGGGCTCGG + Intronic
1083618266 11:64036728-64036750 GCCCTGAGCCGGGCGGGGGCTGG + Intronic
1083671168 11:64300564-64300586 GAACTGAGCCGGGCCGGGTTGGG - Exonic
1083684464 11:64368263-64368285 GGGCTGGGCTGGGCTGGGTTGGG + Intronic
1083885122 11:65569736-65569758 GTGCTGGGCCGGGTCGGGTTGGG - Intergenic
1083955626 11:65981465-65981487 GCCCAGGGCTGGGAGGGGTTGGG + Intergenic
1084053468 11:66616323-66616345 TCTCTGGCCCGGGTGGGGCTGGG - Intergenic
1084164119 11:67367122-67367144 TCTCTTGCGCGGGCGGGGTTGGG - Intronic
1084195789 11:67523185-67523207 TCCGAGGGCCGGGCGGGGTTGGG - Intronic
1084506955 11:69574485-69574507 TCTCTGGGCTGGGCTGGGCTAGG - Intergenic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1089566897 11:119376424-119376446 GCACTGGGCAGGGAGGGGTATGG - Intronic
1089608090 11:119653453-119653475 CCTCAGGGCAGGGCTGGGTTGGG - Intronic
1092209294 12:6635955-6635977 GCTCTGGGCTGGGCTGGGCTGGG + Exonic
1092270382 12:7018686-7018708 GCTCAGGGCTGGGCGGGGCTTGG + Intronic
1095954762 12:47799652-47799674 GCTCTGGGCCTGGCATGGTCAGG + Intronic
1096221023 12:49828241-49828263 GCTCCGGGCCGGGGGGAGTGGGG - Intronic
1096499155 12:52054921-52054943 GCTCTGGGCCAGGCTGGGGCTGG - Exonic
1096796414 12:54080735-54080757 GCTCTTGGCGGGGCTGGGGTTGG - Intergenic
1097733440 12:63154506-63154528 TCTCTGGTCAGGGAGGGGTTTGG - Intergenic
1101340751 12:103840639-103840661 GCTTTGGGCCGCGCGGGGCTGGG - Intronic
1101817702 12:108158455-108158477 TCCCTGGGGCGGGCGGGGTGGGG + Intronic
1101870573 12:108562433-108562455 TCTCGGGGGCGGGCGGGGTCGGG - Intergenic
1102243634 12:111341549-111341571 GCTCCCGGGCGGGCGAGGTTAGG + Intronic
1102570925 12:113826558-113826580 GCTCTGGGTCGGGCATGGTGGGG + Intronic
1102824811 12:115940167-115940189 GCTCAGGGCCGGGCAGTGCTGGG - Intergenic
1103851471 12:123936292-123936314 GCTCTGGGCCGGGAGGAGGCCGG + Exonic
1104659466 12:130600338-130600360 TCTCTGGTCGGGGAGGGGTTTGG - Intronic
1104727261 12:131085696-131085718 GCTCCGAGCCAGGCTGGGTTTGG + Intronic
1105821277 13:24083317-24083339 CCTGTGGGCGGGGCAGGGTTTGG - Intronic
1106087675 13:26557877-26557899 GCTCCGGGCCGGGCGGCTGTCGG + Intronic
1106512375 13:30422344-30422366 GCGCTGGGCGGGGCTGGGCTGGG - Intergenic
1107371632 13:39756733-39756755 GCTCTGGGCGGGGCGGGGGGCGG + Intronic
1113585309 13:111460497-111460519 GCTCAGGGCCAGGCAGGGTGAGG + Intergenic
1113594213 13:111519967-111519989 GCTCTGAGCTGGGCAGGGTGAGG - Intergenic
1113709435 13:112454009-112454031 GCTCTGGGCAGGGCAGGGAGGGG + Intergenic
1114622793 14:24107453-24107475 GGTCGGGGCGGGGCGGGGCTGGG - Intronic
1115556065 14:34546045-34546067 CGTCTGGGCCGGGCAGGGCTCGG - Intergenic
1115557843 14:34557036-34557058 CGTCTGGGCCGGGCAGGGCTCGG + Intergenic
1118339207 14:64880201-64880223 GCTCGGGGTGGCGCGGGGTTAGG - Intergenic
1120135605 14:80865083-80865105 GCTAGGGGCAGGGCAGGGTTGGG - Intronic
1122211703 14:100178055-100178077 GCACTGGGCTGGGCTGGGCTGGG - Intergenic
1122230338 14:100303778-100303800 CCTCAGGGCTGGGCGGGGTGGGG + Intronic
1122797449 14:104213009-104213031 GCTCTGGGCCAGCTCGGGTTGGG + Intergenic
1122891238 14:104733211-104733233 GCTCTGGGCGGGGCGGTGCTGGG - Intronic
1122919243 14:104873286-104873308 GGTGTGGGCCGGGTGGGGTGGGG + Intronic
1122959188 14:105086901-105086923 GCTCCGGGACCGGCGGGGCTGGG - Intergenic
1123005003 14:105316801-105316823 GCTCTGGCCTGGACAGGGTTGGG + Intronic
1123084363 14:105710794-105710816 GGACTGGGCTGGGCTGGGTTGGG - Intergenic
1123084382 14:105710864-105710886 GAGCTGGGCTGGGCTGGGTTGGG - Intergenic
1123084462 14:105711124-105711146 GGGCTGGGCTGGGCCGGGTTGGG - Intergenic
1123084566 14:105711474-105711496 GAGCTGGGCCGGGCCGGATTGGG - Intergenic
1123084583 14:105711549-105711571 GGGCTGGGCTGGGCTGGGTTGGG - Intergenic
1123105775 14:105840445-105840467 GCTGAGGGCTGGGCGGGGCTGGG + Intergenic
1123109381 14:105858570-105858592 GATCTGGGCTGGGCTGGGCTGGG - Intergenic
1125051198 15:35299560-35299582 GCGCTGGGCGGCGCGGGGTCAGG + Intronic
1126102838 15:45129973-45129995 GCGCCGGGACGGGCGGGGCTGGG - Exonic
1126766932 15:52019136-52019158 GCGCTGGGCAGGGCGGGGGCGGG + Intronic
1127953595 15:63833830-63833852 GCTCTGGAGCTGGCGGGGTGGGG + Exonic
1128331046 15:66755893-66755915 TCTCTGGGCTGAGCTGGGTTTGG + Intronic
1128968652 15:72086661-72086683 TCTGTGGGCAGGGAGGGGTTGGG + Intronic
1129738022 15:77976542-77976564 GCGCTGGGCCGGGAGAGGTGTGG + Intergenic
1130253865 15:82316869-82316891 GCGCTGGGCCGGGAGAGGTGTGG + Intergenic
1130913964 15:88290554-88290576 GATCTGGGCAGGGTGGGGTGGGG - Intergenic
1130972211 15:88741965-88741987 GATCTGGGCCGGGAGGGGTGCGG - Intergenic
1131527855 15:93166853-93166875 GGTCTGGGAGGGGCGGGGTGAGG + Intergenic
1132499867 16:280532-280554 GCTCTCTGCCGGGCGCGGCTGGG + Intronic
1132591138 16:726983-727005 GATCCGGGCCGGGCGGGGGCGGG + Intronic
1132622468 16:874341-874363 CCTTTGGGCAGGGCGGGGTGGGG + Intronic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1133116179 16:3579171-3579193 GGGCTGGGCTGGGCTGGGTTGGG - Intergenic
1133466349 16:6030885-6030907 GCTCTGGGCCAGGCACTGTTAGG + Intronic
1134149711 16:11796621-11796643 GCCCTGGGCCGGGCGGGGAGAGG - Intronic
1138349831 16:56340599-56340621 GAGCAGGGCCGGGCAGGGTTGGG - Intronic
1138351259 16:56347472-56347494 TCTCTGGGCAGGGTGGGGTCAGG - Exonic
1138651503 16:58463873-58463895 GCTCGGGGCTGGGCTGGGCTGGG - Intronic
1139522508 16:67492381-67492403 CCTTTGGGCCGGGCGCGGTTAGG - Intergenic
1141038797 16:80654171-80654193 GCGCTCTGCCGGGCTGGGTTGGG + Intronic
1141651691 16:85396275-85396297 GCACTGGGGCGGGGGGAGTTGGG + Intergenic
1141950005 16:87334057-87334079 GCCCTGGGCTGGGCAGGGCTTGG + Exonic
1142177291 16:88651073-88651095 GGCCTGGGCGGGGCGGGGTTCGG - Exonic
1142374903 16:89701734-89701756 GCTGGGGGCGGGGCGGGGCTTGG + Intergenic
1142639816 17:1279426-1279448 CCTCTGGGCTGGGCTGGGCTGGG + Intergenic
1142858926 17:2749448-2749470 GGTCCGGGCCGGGCTGGGTGGGG + Intergenic
1143499212 17:7329244-7329266 GACCGGGGCCGGGCGGGGGTGGG - Exonic
1144556382 17:16286308-16286330 GCTCTGAGCAGGGCTGGGTCTGG + Intronic
1144585463 17:16485016-16485038 GCTCAGGGCCGGGTGGGGGTAGG + Intronic
1144721794 17:17476277-17476299 ACTGTGGGCTGGGCCGGGTTTGG + Intergenic
1145904543 17:28509018-28509040 GATCTGGGGTGGGTGGGGTTGGG + Intronic
1146910212 17:36643640-36643662 GCTCTGAGCAGGGCAGGGGTTGG - Intergenic
1147132818 17:38419174-38419196 GCCACGGGCCGGGCGGGGTGAGG + Intergenic
1147218576 17:38914981-38915003 GCTCTGGGAGGGGCTGGGTTTGG + Intronic
1147239632 17:39082113-39082135 GCTCTGGGCCCAGAGGGGATGGG - Intronic
1147595034 17:41711673-41711695 CCTCTGTGCTGGGCTGGGTTTGG - Intergenic
1147998560 17:44374922-44374944 GCTCTGGGAGGGGCGGGGTTTGG - Intronic
1148109976 17:45138952-45138974 GCTCTGGGCAGGGTGGGGGCAGG - Intronic
1148124840 17:45231270-45231292 GCGCTGGGCTGGGTGGGGCTCGG + Intronic
1148238745 17:45986224-45986246 GCTCAGGGCTGGGCTGGGCTTGG + Intronic
1148836882 17:50470077-50470099 GCTCTGGCACGGCTGGGGTTTGG - Intronic
1148845746 17:50528855-50528877 GGTCTGGGCCAGGTGGGGCTGGG + Intronic
1148930092 17:51120779-51120801 GGGCTGGGCCCGGCGGGGTGGGG + Exonic
1149994571 17:61399965-61399987 GCTCTGCGCGGGGCCGGGCTGGG - Exonic
1150676010 17:67245992-67246014 GCTCCGGGCGGGGCGGGGCGCGG + Intergenic
1151341358 17:73473070-73473092 GCTTTTGGGCTGGCGGGGTTGGG + Intronic
1151411709 17:73934877-73934899 GCTCTGGGCTGAGCAGGGCTGGG - Intergenic
1151565268 17:74893943-74893965 CCTCGGGGCGGGGCGGGGGTGGG - Intergenic
1151875905 17:76868297-76868319 GCCCGGGGCCGTGCGGGGCTGGG - Intergenic
1152262266 17:79273564-79273586 GCTCTGGGGGGGGCGGGGGCGGG + Intronic
1152546761 17:81004172-81004194 GGGCTGGGCTGGGCAGGGTTGGG - Intronic
1152798535 17:82320511-82320533 GCATGGGGCCGGGTGGGGTTGGG + Intergenic
1153229011 18:2919508-2919530 GTTGGGGGCGGGGCGGGGTTTGG + Exonic
1154089415 18:11343695-11343717 TCTCTGGTCAGGGAGGGGTTTGG - Intergenic
1157752960 18:50194794-50194816 GGCCCGGGCCGGGCGGGGCTCGG + Exonic
1158643045 18:59219786-59219808 GATCTGGGCCGGGAGGGGTGGGG - Intergenic
1160735964 19:662608-662630 GGGCTGGGCCTGGCGGGGCTCGG - Intronic
1160812056 19:1017201-1017223 GCTCAGGGCCGGGCCTGGTGAGG - Intronic
1160865481 19:1254097-1254119 GGACTGGGCCGGGCTGGGCTGGG + Intronic
1160930675 19:1568218-1568240 GCTCGGGGCCGGGCCGGGCCGGG + Intergenic
1161039306 19:2101565-2101587 GCTGTGGGCAGGGCGGGGCCAGG - Exonic
1161399595 19:4061441-4061463 GGACTGGGCCAGGCGGGGCTTGG - Intronic
1161791303 19:6361805-6361827 GCTCCGGGCTGGGTGGGGATCGG + Intronic
1162015469 19:7844524-7844546 TCTCTGGGCAGGGAGGGGCTGGG - Intronic
1162176383 19:8832871-8832893 GCTCCGGGCCGGGCGGAGGGCGG + Intronic
1162899280 19:13785057-13785079 GCTCTGGGCCAGGACGGGGTGGG + Intergenic
1163020151 19:14477346-14477368 GCATTGGGCCGGGTGGGGTGGGG + Intergenic
1163034165 19:14561967-14561989 GCTCTGTGCAGGGCGGGGGCTGG + Intronic
1163125771 19:15243403-15243425 GCTGGGGGCCGGGCGGGCTTGGG + Exonic
1163468105 19:17481210-17481232 CCACTGGGCCCGGCGGTGTTTGG + Intronic
1163551788 19:17969551-17969573 GCCCTGGGCAGGGAGGGGGTGGG - Intronic
1163613251 19:18311750-18311772 GCACAGGGCTGGGCGGGGTGGGG - Intronic
1163827920 19:19533898-19533920 GCTCTGGGCCCGGTGTGGCTGGG + Intronic
1167001066 19:46746099-46746121 GGGCCGGGCCGGGCCGGGTTGGG + Intronic
1167849602 19:52191200-52191222 GCTCTGAGCCGGGCTGGTGTGGG + Intronic
1168319731 19:55501582-55501604 GCTCTGGTCCGGGCCTGGTATGG + Intronic
925027250 2:619899-619921 TCTCTGGGCAGGGTGGGGTCTGG + Intergenic
925152712 2:1626363-1626385 GCTCTGGGCTGGGCTGTGTCCGG - Intergenic
926152360 2:10432310-10432332 GCCCTGGGCTGGGCGCCGTTGGG + Intergenic
926474746 2:13308407-13308429 GCGGTGGGCTGGGCGGGGTGGGG + Intergenic
929484749 2:42343215-42343237 TCTCTGTGACTGGCGGGGTTTGG - Intronic
929779802 2:44950095-44950117 CCACTGTGCCGGGCGGGGCTCGG + Intergenic
932714632 2:74092427-74092449 GCTCTGGGCTGGGCTGGGCTGGG + Intronic
933753211 2:85616466-85616488 GCGCGGGGCCGGGCCGGGCTAGG + Intronic
933940933 2:87244609-87244631 GAGCTGGGCCAGGCGGGGTGAGG + Intergenic
934618688 2:95791180-95791202 GCTCTTTGCCGGGCAGGCTTGGG + Intergenic
934642205 2:96033377-96033399 GCTCTTTGCCGGGCAGGCTTGGG - Intronic
935141240 2:100354724-100354746 GCTCTGGGCAGGGGAGAGTTGGG + Intergenic
935820219 2:106886661-106886683 GCTCTGGGGCGAGCGGAGCTCGG - Intronic
936055608 2:109259854-109259876 CCTCTGGGCCGGGCGCTGTGGGG + Intronic
936352206 2:111721404-111721426 GAGCTGGGCCAGGCGGGGTGAGG - Intergenic
937257423 2:120565165-120565187 GTCCTGGGGCCGGCGGGGTTGGG + Intergenic
938322018 2:130372197-130372219 GCGCTGGGCAGGGCGGGAGTGGG - Intronic
946689814 2:222301580-222301602 GCTCTGAGCCGGGTTAGGTTTGG - Intronic
947683753 2:232062084-232062106 GCTACGGGGCGGGCTGGGTTGGG + Intronic
948484481 2:238271827-238271849 TCTCTGGTCCGGGAGGAGTTTGG - Intronic
948611164 2:239167946-239167968 GCTCTGGGTGGGGCGGGGCGGGG + Intronic
948800558 2:240431540-240431562 ACTCTGGGCTGAGCTGGGTTTGG - Intergenic
948828677 2:240586792-240586814 GGGCTGGGCCGGGCGGGGAACGG + Exonic
948890067 2:240903266-240903288 GCTCTCGGGAGGGCGGGGCTCGG - Intergenic
1168878187 20:1185348-1185370 GCTCCGGGCCGGGCCGGGAAGGG - Intronic
1170598004 20:17819963-17819985 AATCTGGGCAGGGCTGGGTTGGG + Intergenic
1171974784 20:31587693-31587715 GCTCTGGGCTGGCCGGGGGAAGG - Intergenic
1172272607 20:33663188-33663210 GCCCTGGACCAGGCGGGGGTGGG + Intronic
1175841877 20:62033165-62033187 GCTCTCAGCAGGGCGGGGTCAGG + Intronic
1175925660 20:62470171-62470193 GCTCTGGGCAGGGCAGGGCCCGG + Intronic
1176191227 20:63811117-63811139 TCTGTGGGCTGGGCGGGGTGGGG - Intronic
1176191247 20:63811180-63811202 CCTGTGGGCTGGGCGGGGTGGGG - Intronic
1176551771 21:8226184-8226206 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1176570680 21:8409183-8409205 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1176578589 21:8453330-8453352 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1176860703 21:14010173-14010195 GCCCTGGGCTGGGCAGGGTCTGG + Intergenic
1178160826 21:29912280-29912302 TCTCTGGTCAGGGAGGGGTTTGG - Intronic
1178895545 21:36554219-36554241 GCCCAGGGCCTGGGGGGGTTGGG - Intronic
1179148177 21:38787525-38787547 GGGCTGGGCCGGGTGGGGGTGGG - Intergenic
1179876055 21:44268105-44268127 GCTCTGGACCGGGCTCGGCTAGG - Intergenic
1179893834 21:44350675-44350697 GTGCAGGGGCGGGCGGGGTTCGG + Intronic
1180004108 21:45012075-45012097 GCCCTGGGCGGGGCGGTGTGTGG - Intergenic
1180167886 21:46039391-46039413 GCTCAGGGTCTGGCGGGGTGTGG - Intergenic
1180406869 22:12563453-12563475 GCTCTGTGCCAGGCGGTGTCTGG - Intergenic
1180954598 22:19736041-19736063 GGGCTGGGCCGGGAGGGCTTAGG + Intergenic
1181028310 22:20138088-20138110 GCTCTTGGCCAGGCGGGCGTGGG + Intronic
1181063166 22:20291648-20291670 GCTTTGTGCCAGACGGGGTTTGG - Intergenic
1181458004 22:23070515-23070537 GCTCCGGGCAGGGCGGGGCGGGG - Exonic
1181459674 22:23078664-23078686 GCTCTGGGTGGGCCAGGGTTTGG + Intronic
1181513398 22:23398775-23398797 GGGCTGGGCTGGGCGGGGCTGGG + Intergenic
1182137974 22:27923528-27923550 ACTCTGGGACGGACAGGGTTAGG + Intergenic
1183386848 22:37519646-37519668 CCTCTGGGCGGGGCGGGGGCGGG + Intergenic
1183490398 22:38112610-38112632 GGTGCGGGCCGGGCGGGGTGTGG - Intronic
1183490406 22:38112626-38112648 GGGCAGGGCCGGGCGGGGTGCGG - Intronic
1183933018 22:41246862-41246884 GCTCTGGGCTGTGTGGCGTTGGG - Intronic
1184474441 22:44712906-44712928 GCACTGGGAAGGGAGGGGTTGGG + Intronic
1185094379 22:48798419-48798441 GCTCTGGGGCGCGCTGGCTTTGG - Intronic
1185276024 22:49950504-49950526 GGCCTGGGCCGGGCTGTGTTTGG + Intergenic
1185288764 22:50013906-50013928 GCTCTAGGCCAGGCGGGGGCAGG - Intergenic
1185365982 22:50436918-50436940 GCGCTGGGCTGGGTGGGGTCTGG + Intronic
1203256792 22_KI270733v1_random:143101-143123 GCTCTGGGCGGGGCGGGGCGAGG + Intergenic
950467476 3:13163727-13163749 GGGCTGGGCTGGGCGGGGTCAGG - Intergenic
951605985 3:24435492-24435514 GCTCAGGGCCCTGGGGGGTTTGG - Intronic
952354253 3:32570304-32570326 GCTGGGGGCCGGGCGGGGCGGGG + Intronic
954299062 3:49689626-49689648 GCTCTGAGCCTGGCGGGTTCCGG + Intronic
954300748 3:49699592-49699614 GGTCTGGGCCAGGCGGGGTGGGG + Intronic
954912589 3:54122075-54122097 CCCCTGGGCCGGGCGGGGTCGGG - Intergenic
955692942 3:61607878-61607900 TCTCCAGGCCTGGCGGGGTTGGG + Intronic
956612238 3:71135708-71135730 GCTCTGGGCAGGCCCTGGTTTGG - Intronic
956832705 3:73069275-73069297 GCGCAGGGTCGGGGGGGGTTGGG - Intergenic
956979034 3:74614823-74614845 GCGCAGGGCCGCGCGGGGTCCGG - Intergenic
957276373 3:78095340-78095362 GCTGTGGGCCTGGTGGGGGTGGG - Intergenic
958269162 3:91477422-91477444 TCTCTGGTCAGGGAGGGGTTTGG - Intergenic
959398367 3:105869044-105869066 GCTCGGGGCGGGGCGGGGCGGGG + Intronic
959990062 3:112621471-112621493 GATCTGGGCTGGGCTTGGTTAGG - Intronic
961322252 3:126084061-126084083 GCCCTGTTCCGGGCGGGGTTGGG - Intronic
961536819 3:127575708-127575730 GCTCTGGGACAGGCGGGGATGGG - Intronic
962818091 3:139020530-139020552 GCTGGGTGCCGCGCGGGGTTCGG + Exonic
964054072 3:152430826-152430848 GCTTTGTGCTGGGAGGGGTTGGG + Intronic
964703051 3:159590249-159590271 GCGCTGGGCTGGGGTGGGTTAGG - Intronic
964801835 3:160565729-160565751 GCTCCGGGCCCGGAGGGGTGCGG + Intergenic
966182012 3:177197020-177197042 GCGCTGGGCCGCGGGGGGATGGG - Intronic
966743467 3:183254304-183254326 GCGCTGGGCCGTGCGCGGTCCGG - Intronic
967387957 3:188928918-188928940 GCTCTGGGCCAGGCCAGGTGTGG + Intergenic
967881055 3:194301911-194301933 GCTCCAGGCCTGGCGGGGGTGGG - Intergenic
967939530 3:194755543-194755565 ACTCTGGGTCGTGCGGAGTTGGG + Intergenic
968729181 4:2261687-2261709 GGACCGGGCCGGGCGGGGTCGGG + Intronic
968754691 4:2409239-2409261 GATCTGGGCCTGGTGGGGGTGGG - Intronic
968764664 4:2462239-2462261 GCTCAGGGGCTGGAGGGGTTGGG - Intronic
968802938 4:2755515-2755537 GCTCTGGGTCCTGCGGGGTGAGG - Intronic
968815325 4:2818658-2818680 CCTTCGGGCCGGGCGCGGTTGGG + Intronic
968815353 4:2818756-2818778 CCTCTGGGCAGGGAGGGGTCAGG - Intronic
968881461 4:3302373-3302395 GGTCTGGGGTGGGTGGGGTTGGG + Intronic
968916428 4:3498836-3498858 CCTCAGGGCCAGGCAGGGTTGGG + Intronic
969278927 4:6156172-6156194 GCTCTGTGCCGGGCGTGGTACGG - Intronic
969625954 4:8305899-8305921 GCTCTGGGCCGGGCCTGGGAAGG + Intronic
970692003 4:18630817-18630839 GCCCTGGGCCGTGAGGGGCTTGG - Intergenic
973729613 4:53810876-53810898 CCTATGGGCCTGGCTGGGTTAGG + Intronic
973777267 4:54254972-54254994 GCACTGGGCCGGGTGGGGGGCGG + Intronic
975689511 4:76949980-76950002 GCTCTGGGGCGGGTGCGGTGAGG + Intronic
980136985 4:128867538-128867560 CCTCTGTGCCGGGATGGGTTAGG + Intronic
985643267 5:1073613-1073635 GAGGTGGGCCGGGCGGGGTCTGG - Exonic
985748290 5:1660137-1660159 GCGCTGGGCCAGGCGGGGTCGGG - Intergenic
985936474 5:3101515-3101537 CCTGGGGGCCGGGCTGGGTTGGG - Intergenic
986311480 5:6554129-6554151 GCGCTGGGCTGGGCCGGGGTGGG - Intergenic
990030999 5:51259418-51259440 CTTCTTGGCCGGGCGCGGTTTGG + Intergenic
995735668 5:115296869-115296891 GTTCTGGGGCGGGCGGGTGTGGG + Intergenic
998138499 5:139687128-139687150 GCGCTGGGCAGGCTGGGGTTGGG - Intergenic
999202232 5:149824664-149824686 GTTCTGGGCTGGACAGGGTTGGG + Intronic
999245045 5:150149699-150149721 GCTCTGGGCCAGGAGGGGCCAGG + Intronic
1001080387 5:168663209-168663231 GCTCTGGGCTGGGTGGGGAGAGG + Intronic
1001617747 5:173056583-173056605 GCTCTGGGCCGGGCCGGCGCGGG + Intronic
1002075095 5:176703649-176703671 GCCCTGGGCATGGTGGGGTTTGG + Intergenic
1002524267 5:179806717-179806739 GCCCGGGGCCGGGCGGGGACCGG + Intronic
1003865303 6:10357534-10357556 GCTCTAGGCCGGAAGGAGTTGGG + Intergenic
1005859250 6:29888413-29888435 GGTCGGGGCAGGGCGGGGCTCGG + Intergenic
1005866817 6:29943214-29943236 GGTCGGGGCTGGGCGGGGCTCGG + Intronic
1006043125 6:31271380-31271402 GGTCGGGGCGGGGCGGGGCTCGG - Intronic
1006052715 6:31356474-31356496 GGTCGGGGCGGGGCGGGGCTCGG - Intronic
1007398336 6:41589867-41589889 GCTCTGGGAGGGGCGGGGAGGGG - Intronic
1008295633 6:49772479-49772501 TCTCTGGTCAGGGAGGGGTTTGG + Intergenic
1008986063 6:57544318-57544340 TCTCTGGTCAGGGAGGGGTTTGG + Intronic
1009174022 6:60436869-60436891 TCTCTGGTCAGGGAGGGGTTTGG + Intergenic
1012052607 6:94362547-94362569 GCTCTGGGCCTGGAGGGGGGTGG + Intergenic
1013196512 6:107849092-107849114 GCTGGGGGACGGGCGGGGTGGGG - Intergenic
1014215024 6:118745164-118745186 GCCCTGGGCTGGGTGGGGATGGG - Intergenic
1014246888 6:119078782-119078804 GCGCGGGGCTGGGCGGGGCTTGG - Intronic
1016634114 6:146267640-146267662 GCGCTGGGCTGGGCTGGGCTGGG + Intronic
1016924529 6:149329661-149329683 GAGCTGGGGGGGGCGGGGTTGGG + Intronic
1018757587 6:166863062-166863084 GCTCCGGGCAGGGCTGGGTAGGG - Intronic
1019294657 7:267340-267362 GCTCTGGGCCGGGCTGAGGGAGG - Intergenic
1019303725 7:322459-322481 GCCCTGGACGGAGCGGGGTTGGG + Intergenic
1019350039 7:550319-550341 GGTGTGGGCCGGGTGGGGCTGGG - Exonic
1019560655 7:1654944-1654966 GCGCTGGGCGGGGCGAGGCTGGG - Intergenic
1019623986 7:2006528-2006550 GTGCTGGGCCGTGCGGGTTTCGG - Intronic
1022466961 7:30658427-30658449 GCTGGGGGCCTGGAGGGGTTGGG + Intronic
1025610419 7:63072202-63072224 TCTCTGGGCCGGTGGGGGGTGGG - Intergenic
1029290732 7:99500389-99500411 CCTCTGCGTCGGGCGGGGCTAGG - Intronic
1029539142 7:101172791-101172813 GCTCCGGGCCGAGTGGGGTATGG + Intronic
1031937594 7:127751699-127751721 TCTGTGGGCTGGGCAGGGTTTGG + Intronic
1034423667 7:151001895-151001917 GCTCTGGGCCCGGCCGGTCTCGG - Exonic
1035404385 7:158588129-158588151 GCACCGGGCCGGGCGGGGAGCGG - Intergenic
1035436579 7:158864027-158864049 GCTCTGGGTGTGGCGGGGTGGGG + Intronic
1035553082 8:544861-544883 CCAGTGGGCCGGGCGGGGCTAGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036574288 8:10011303-10011325 GTTCTGGACAGGGCGGGGTGGGG + Intergenic
1036664333 8:10729245-10729267 GTTCCGGACCGGGTGGGGTTTGG + Intronic
1037820902 8:22134056-22134078 GCCCTGGCCCAGGCTGGGTTGGG - Intergenic
1039887863 8:41665425-41665447 TCTCTGGGCAGGGCGGGGTTAGG - Intronic
1041281028 8:56211396-56211418 GCGCAGCGGCGGGCGGGGTTTGG - Intergenic
1041552766 8:59119510-59119532 GTCCCGGGCCGGGCGGGGTAGGG + Intergenic
1048234350 8:132675340-132675362 GCGGAGGGCCGGGTGGGGTTAGG + Intronic
1049229101 8:141472954-141472976 GCTGTGGGGCGGGCAGGGTCAGG + Intergenic
1049543136 8:143217704-143217726 GGTGTGGGCCGGGAGGGGTGGGG - Intergenic
1049766662 8:144358272-144358294 GCGCGGGGCCGGGCGGGGCCGGG + Exonic
1049783572 8:144439962-144439984 GCTCTGGGCCGGGCTGGAGAGGG - Intronic
1049788510 8:144462580-144462602 GCTCCGTGCCGGCCGGGGTCGGG - Intronic
1049803464 8:144528692-144528714 TCTCTGGGCGGGGCGGGGGGGGG - Intronic
1051079546 9:13279186-13279208 GCGCCGGGCCGCGCGGGGTGGGG + Intronic
1051905018 9:22085315-22085337 GCACTTGGCAGGGTGGGGTTGGG - Intergenic
1054159033 9:61660779-61660801 GCTCTTGGCGGGGCTGGGGTTGG + Intronic
1054478807 9:65591784-65591806 GCTCTTGGCGGGGCTGGGGTTGG + Intergenic
1057311694 9:93947341-93947363 GCTTGGGGCGGGGCGGGGTGGGG - Intergenic
1057810560 9:98253894-98253916 GCTCTGCGCTTGGCGGGGTGTGG - Intronic
1059185600 9:112267425-112267447 GTTTTTGGCCGGGCGCGGTTTGG - Intronic
1060106526 9:120876585-120876607 GCGCGGGGCCGGGCGGGGGCAGG + Intronic
1060302526 9:122383599-122383621 GCTGTGGGCCAGGAGGTGTTTGG + Exonic
1060402849 9:123358227-123358249 GCTCAGGGCCTGGCAGGGGTGGG - Intronic
1060817240 9:126641537-126641559 GAGCTGGGCTGGGCTGGGTTAGG + Intronic
1060897095 9:127225091-127225113 GGTCTGGGCAGGCTGGGGTTCGG + Intronic
1061035885 9:128114170-128114192 GCCCTGGGGCGGGCGTGGTGGGG + Intergenic
1061196692 9:129110672-129110694 CCTCTGGGCCGAGCGGGCTGCGG + Exonic
1061836725 9:133334346-133334368 GTTCTGTGCAGGGCGGGGCTGGG - Intronic
1062153455 9:135033259-135033281 GTTCTGGGCAGGGCGGGGCCAGG - Intergenic
1062155506 9:135046034-135046056 GAACTGGCCCGGGCGGGGTGTGG + Intergenic
1062235670 9:135506492-135506514 GCTCAGGGCAGGGTGGGGTGGGG + Intergenic
1062615304 9:137393494-137393516 CCTCTGAGCTGGGCGGGGCTTGG - Intronic
1203472950 Un_GL000220v1:124788-124810 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1186309155 X:8298754-8298776 GATCCGGGCCTGGCGGGGTCAGG - Intergenic
1186609293 X:11123473-11123495 TCTCGGGGCCGGGGGGGGGTGGG + Intergenic
1188242619 X:27809440-27809462 GGGCGGGGGCGGGCGGGGTTGGG - Intronic
1188274088 X:28178633-28178655 GCTCAGTGCGGGGCGGGGTGGGG + Intergenic
1188995292 X:36877501-36877523 GCTTTGGGAGGGGCAGGGTTGGG + Intergenic
1189323004 X:40097520-40097542 GCTCTGGGCCGGGTGGGGGCGGG + Intronic
1190428051 X:50350982-50351004 GCTCTTGGCCAGGCGTGGTAGGG - Intronic
1197488821 X:127090267-127090289 GCTATGGGCCTGGGGTGGTTGGG - Intergenic
1199982285 X:152927748-152927770 GCTCTGGGCCCAGCAGGGTCAGG - Intronic