ID: 1070112328

View in Genome Browser
Species Human (GRCh38)
Location 10:73497697-73497719
Sequence CCTTTTGAACAGATGGAGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070112328_1070112336 22 Left 1070112328 10:73497697-73497719 CCTGACTCCATCTGTTCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 252
Right 1070112336 10:73497742-73497764 CGCATTCTAGGCCTAAGGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 35
1070112328_1070112338 26 Left 1070112328 10:73497697-73497719 CCTGACTCCATCTGTTCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 252
Right 1070112338 10:73497746-73497768 TTCTAGGCCTAAGGTTTGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 128
1070112328_1070112334 17 Left 1070112328 10:73497697-73497719 CCTGACTCCATCTGTTCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 252
Right 1070112334 10:73497737-73497759 AGCTCCGCATTCTAGGCCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1070112328_1070112332 -7 Left 1070112328 10:73497697-73497719 CCTGACTCCATCTGTTCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 252
Right 1070112332 10:73497713-73497735 CAAAAGGGTGAATGTTATGTTGG 0: 1
1: 0
2: 1
3: 6
4: 157
1070112328_1070112333 10 Left 1070112328 10:73497697-73497719 CCTGACTCCATCTGTTCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 252
Right 1070112333 10:73497730-73497752 TGTTGGCAGCTCCGCATTCTAGG 0: 1
1: 0
2: 2
3: 8
4: 108
1070112328_1070112337 25 Left 1070112328 10:73497697-73497719 CCTGACTCCATCTGTTCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 252
Right 1070112337 10:73497745-73497767 ATTCTAGGCCTAAGGTTTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070112328 Original CRISPR CCTTTTGAACAGATGGAGTC AGG (reversed) Exonic
901139314 1:7018138-7018160 GCTTTTTAACAGATGGTCTCAGG + Intronic
904118872 1:28182494-28182516 GTTTTTGTAAAGATGGAGTCTGG - Intronic
904302508 1:29563541-29563563 CCATCTGATCAGGTGGAGTCTGG + Intergenic
905572871 1:39019922-39019944 CCTTTTCAACAAATGGTGCCTGG - Intergenic
907200165 1:52719721-52719743 CTTTTTGTACAGACGGGGTCTGG - Intergenic
907504044 1:54904215-54904237 TTTTTTGTACAGATGGGGTCAGG + Intergenic
912140788 1:106723910-106723932 CTTTTTGAACAGCTGTTGTCTGG + Intergenic
915534081 1:156524029-156524051 TCTTTTCAACAAATGGTGTCAGG - Intergenic
915924607 1:160006267-160006289 ATTTTTGTAGAGATGGAGTCTGG + Intergenic
917429957 1:174955902-174955924 ACTTTTGTAGAGATGGGGTCTGG - Intronic
922063639 1:222115334-222115356 CTTTTGGTACAGATGGGGTCTGG + Intergenic
923986811 1:239390957-239390979 CTTTTTGTAGAGATGGGGTCTGG - Intronic
924650884 1:245926220-245926242 AGTTTTCAACAGATGGAATCTGG + Intronic
1065352055 10:24804401-24804423 CCTTTGGAACGGAAGAAGTCGGG - Intergenic
1065823985 10:29552993-29553015 ACTTTTTAAGAGGTGGAGTCTGG + Intronic
1066131530 10:32399220-32399242 CCTTTTTTAAAGATGGGGTCTGG + Intergenic
1067847528 10:49735950-49735972 CCTATGGGACAGATGGAGCCAGG + Intronic
1070112328 10:73497697-73497719 CCTTTTGAACAGATGGAGTCAGG - Exonic
1070306219 10:75240704-75240726 GCTTTAGAACAGATGGACTTGGG + Intergenic
1071905876 10:90173091-90173113 CCTTTTATAGAGATGGAGTGGGG + Intergenic
1072380502 10:94864287-94864309 CCTTTTCAACAGATGGTGCTGGG - Intergenic
1072953819 10:99871541-99871563 TCTTTTGCACAGATGGTGCCAGG - Intergenic
1076550909 10:131277771-131277793 CCTTTTGACCAGATGTCCTCAGG - Intronic
1077222743 11:1424718-1424740 CTGTTTGGACAGAGGGAGTCGGG + Intronic
1078765666 11:14295129-14295151 ACATTTAATCAGATGGAGTCAGG + Intronic
1079399905 11:20098378-20098400 CCTTTTTAACAGCAGGAGTTAGG - Intronic
1080293886 11:30702975-30702997 CCTTAGGGATAGATGGAGTCAGG + Intergenic
1081755103 11:45538747-45538769 ACTTTAGAACAGACGGATTCTGG + Intergenic
1085293499 11:75417290-75417312 ATTTTTTAAGAGATGGAGTCTGG - Intronic
1088035953 11:105316010-105316032 GGTTTTGTTCAGATGGAGTCTGG + Intergenic
1088180015 11:107098626-107098648 CCTTTTCAACAAATGGCGCCGGG + Intergenic
1091641984 12:2244339-2244361 GCTTTTGAACAGAAGCACTCAGG + Intronic
1091874650 12:3924016-3924038 CCTTTTCAATAGATGGAGAAGGG + Intergenic
1092505073 12:9090397-9090419 CCGTTTGCACAGATGCAGTGAGG + Exonic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1095247671 12:39941942-39941964 CCTTTTCAACAGATGGTGTTGGG - Intronic
1095862026 12:46927965-46927987 TCTTTTTAACAGATGGAACCAGG - Intergenic
1097882695 12:64700438-64700460 ATTTTTGTAAAGATGGAGTCAGG + Intergenic
1097965020 12:65569990-65570012 CCTTCTGAAGAGTTGGAGTTGGG - Intergenic
1098005651 12:65994163-65994185 GCTTTTGAACAGTTGGAATGTGG + Intergenic
1098104666 12:67056688-67056710 CCTTTTGAACAGATGATGATGGG - Intergenic
1101024739 12:100589833-100589855 CCTTTTCAACAAATGGTGCCGGG + Intronic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102949094 12:117016864-117016886 TCTTTTCAACAGATGGTGCCAGG - Intronic
1104778377 12:131404522-131404544 CCTTCTGGACAGAGGCAGTCGGG - Intergenic
1105780721 13:23703124-23703146 ACTTTTGTAGAGATGGTGTCTGG - Intergenic
1110061905 13:71051824-71051846 CCTTTTGTAGAGACAGAGTCTGG + Intergenic
1110070419 13:71169254-71169276 CATTTTGAACAGATGGTGGCTGG + Intergenic
1110600702 13:77369508-77369530 CCTATTCAACAGATGGTGTTGGG + Intergenic
1112665532 13:101568131-101568153 CCTTTTTAACAGATGTAATCCGG - Intronic
1114888492 14:26885895-26885917 TCTTTTCAACAAATGGTGTCGGG - Intergenic
1115639077 14:35320542-35320564 TCTTTTGCACAGAGGAAGTCTGG + Intergenic
1115825777 14:37272019-37272041 CCATTTGAACAGTTTGAATCAGG + Intronic
1116117631 14:40676978-40677000 CCTTTTCAACAAATGGTGCCGGG + Intergenic
1116335896 14:43656056-43656078 ACTTTTCAACAGATGGTATCAGG + Intergenic
1117137273 14:52748405-52748427 GTTTTTGTAGAGATGGAGTCTGG + Intronic
1118423355 14:65632949-65632971 CCTTTTCAACAAATGGTGCCGGG - Intronic
1118510316 14:66464738-66464760 TCTTTTGAAGAGATAGAGACTGG - Intergenic
1118965335 14:70577789-70577811 TCTTTTCAACAAATGGAGTTGGG + Intergenic
1118993241 14:70814462-70814484 GCATTTGAAGAGATGGAGGCAGG - Intergenic
1121172178 14:91863813-91863835 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1122457113 14:101863004-101863026 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1122563590 14:102635009-102635031 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1125483554 15:40096916-40096938 CATTTTGAAGAGATTGAGTGTGG - Intronic
1125840215 15:42793538-42793560 TTTTTTTAAGAGATGGAGTCTGG - Intronic
1126289918 15:47062754-47062776 CCTTATGAACAAATGAAGTTGGG + Intergenic
1129447370 15:75628046-75628068 CCTTTTAAATAAATGTAGTCAGG - Intergenic
1130262289 15:82365254-82365276 CCACTTGAAAAGATTGAGTCTGG + Intergenic
1130278939 15:82503753-82503775 CCACTTGAAAAGATGGAGTCTGG - Intergenic
1130623197 15:85485502-85485524 CCACTTGAAAAGATTGAGTCTGG + Intronic
1131251880 15:90836421-90836443 TCTTCTGAACAGCTGGAGTTGGG + Intergenic
1131915020 15:97255665-97255687 CTTTTTAAACAAATGGAGACAGG - Intergenic
1133880096 16:9773548-9773570 TCTTGGGAACAGATGGAGCCTGG + Intronic
1134146565 16:11769409-11769431 CCTTTTGAAAATATGGGGCCAGG + Intronic
1134588439 16:15432840-15432862 CCTTTTAAAAAGATAGAGACAGG - Intronic
1135602334 16:23794024-23794046 CTTTTGGAAGGGATGGAGTCTGG + Intergenic
1137430492 16:48414473-48414495 ACTTTTGTAGAGATGAAGTCTGG + Intronic
1137706057 16:50536592-50536614 CCTTTTTTTGAGATGGAGTCTGG - Intergenic
1141883884 16:86878782-86878804 CCTGTCGGACAGATGGAGGCTGG - Intergenic
1142270252 16:89085306-89085328 ACTTTTGAACTCATGGAGCCGGG + Intergenic
1142326624 16:89419758-89419780 CGTTTTGCAAAGATGGAGTGAGG + Intronic
1147271400 17:39274454-39274476 CTTTTTGTAGAGATGGGGTCAGG - Intronic
1150027722 17:61695223-61695245 TCTTTTCAACAGATGGTGTTGGG - Intronic
1150067863 17:62126425-62126447 CATTTTGAACAGGTGAAATCTGG - Intergenic
1150492074 17:65581238-65581260 TTTTTTGTAGAGATGGAGTCTGG + Intronic
1150566841 17:66349573-66349595 CCTTTTGAACAGTTTGGGTATGG + Intronic
1151261000 17:72915824-72915846 ACTTTTGAAAAAATGGATTCGGG - Intronic
1155152420 18:23133981-23134003 CCTTTTGAAAACATGGAGCCTGG - Intergenic
1155975489 18:32124582-32124604 CATTTTGAACATATGTATTCAGG - Intronic
1156618646 18:38821288-38821310 CCTATTGAATAGATGGTGCCAGG + Intergenic
1156976238 18:43224901-43224923 CCTTTTCAACAAATGGTGCCGGG - Intergenic
1157147784 18:45183082-45183104 GCTTATGAACAGATGGACCCAGG - Intergenic
1157601980 18:48898884-48898906 TCTTTTCAACAGATGGTGTTGGG + Intergenic
1162645575 19:12047550-12047572 TTTTTTTAACCGATGGAGTCTGG - Intronic
1162713317 19:12612214-12612236 TTTTTTTAACAGATGGGGTCTGG + Intronic
1164300464 19:23957408-23957430 CGTTTTGATCACCTGGAGTCTGG - Intergenic
1164553445 19:29231917-29231939 TTTTTTGTAGAGATGGAGTCTGG - Intergenic
1164965783 19:32481591-32481613 TTTTTTGTAAAGATGGAGTCTGG + Intronic
1165242200 19:34477832-34477854 CCTTTGGAACAGTGGGACTCAGG + Intergenic
1165298847 19:34954341-34954363 TCTTTTGAACAAATGGTGTTAGG + Intergenic
1165911132 19:39228616-39228638 CCTTTTCAACAAATGGTGTTTGG + Intergenic
1166089777 19:40501225-40501247 TTTTTTCAAGAGATGGAGTCTGG - Intronic
1167654701 19:50755982-50756004 ACTTTTGAACCGATGGAAGCTGG - Intergenic
1167656380 19:50767061-50767083 ACTTTTGAACCGATGGAAGCTGG - Intergenic
1167659580 19:50788772-50788794 TCTTTTATAGAGATGGAGTCGGG + Intergenic
1168142861 19:54400927-54400949 TTTTTTAAAGAGATGGAGTCTGG - Intergenic
925388980 2:3482828-3482850 GCCTCTGAACTGATGGAGTCTGG - Intronic
926105018 2:10144660-10144682 CCTTTTGAACGGAAGGGCTCCGG + Intronic
926216058 2:10905982-10906004 CATGTTGGGCAGATGGAGTCTGG - Intergenic
927040703 2:19227646-19227668 CCTTTTGCTAAGTTGGAGTCAGG + Intergenic
930717343 2:54605185-54605207 CCTTTTGAGAAGATGAAGTTTGG + Intronic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
930832804 2:55763225-55763247 TTTTTTGTAGAGATGGAGTCGGG + Intergenic
931278572 2:60766663-60766685 TTTTTTAAACAGATGGAGACGGG - Intronic
931664672 2:64601687-64601709 CCTGTTGAAAGGATGTAGTCAGG + Intergenic
931993278 2:67812466-67812488 CCTTTTCAACAGATGGTGCTGGG + Intergenic
932768088 2:74483678-74483700 CCTTGGGAAAAGATGGAGGCCGG + Intronic
934141093 2:89048477-89048499 ACTTTACAACAGATGGATTCTGG - Intergenic
934220775 2:90080448-90080470 ACTTTACAACAGATGGATTCTGG + Intergenic
934228143 2:90152065-90152087 ACTTTACAACAGATGGATTCTGG + Intergenic
935527774 2:104192598-104192620 CATTTAAAACAAATGGAGTCGGG + Intergenic
936796578 2:116213655-116213677 CCATGTTAACAGATGTAGTCTGG + Intergenic
937185554 2:120037637-120037659 TCTTTTGTAGAGATGGGGTCTGG - Intronic
937945761 2:127334619-127334641 TTTTTTGTAGAGATGGAGTCTGG + Intronic
938027533 2:127963405-127963427 TCTTTTGTAGAGATGGAGTTTGG + Intronic
938374927 2:130798835-130798857 CCTTTTGAACATGTGGAACCAGG - Intergenic
940405042 2:153291722-153291744 CCTTTTGAACACAAGTAGCCTGG - Intergenic
941300583 2:163796062-163796084 AATTTTGAAGAGATGGAGCCAGG - Intergenic
941927087 2:170906697-170906719 CCTTGTGAACAGATGAGGCCAGG + Intergenic
942476523 2:176330207-176330229 CCATTTGAATATATGGATTCAGG + Intronic
942896517 2:181062142-181062164 ACTTCTGAGCAGTTGGAGTCAGG + Intronic
945079922 2:206078497-206078519 ACTTTTGAACATATGAAGGCCGG + Intronic
946890854 2:224274718-224274740 CCTTTTAAAAATATGGAGTAAGG - Intergenic
947211223 2:227710382-227710404 ATTTTTGTAGAGATGGAGTCTGG - Intronic
948679741 2:239625754-239625776 CCCTTTTAACCCATGGAGTCAGG + Intergenic
948800598 2:240431729-240431751 CCTTTTGATCAGCAGAAGTCTGG - Intergenic
1168926868 20:1588715-1588737 CCTCTTGAACTGAGGGAGGCAGG - Intronic
1169335683 20:4754374-4754396 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1169812291 20:9620451-9620473 TCTTTTGACCACATGGCGTCTGG + Intronic
1170890404 20:20370310-20370332 GCTTGTGAACTGCTGGAGTCTGG + Exonic
1171029587 20:21665402-21665424 CCCTTTGAAGAGATGGAATGGGG - Intergenic
1172167267 20:32907013-32907035 CCTGAGGAACAGAAGGAGTCAGG - Intronic
1172854646 20:37992575-37992597 ATTTTTGAAAAGATGAAGTCAGG - Intronic
1174346503 20:49934243-49934265 CTTTTTGTAGAGATGAAGTCTGG - Intergenic
1174826959 20:53777111-53777133 GTTTTTGTAGAGATGGAGTCTGG - Intergenic
1175551239 20:59819347-59819369 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1175866250 20:62178721-62178743 ATTTTTGTAGAGATGGAGTCTGG + Intronic
1177346095 21:19873417-19873439 CCTTTTTAACAGATGGTGCTGGG + Intergenic
1177853919 21:26380416-26380438 TCTTTTGAAGAGATGAAGCCTGG - Intergenic
1180251147 21:46590187-46590209 CCTTTTCAACAAATGGTGTGGGG + Intergenic
1181936952 22:26445888-26445910 CCTTTAGAAGAGAGGGAGACAGG + Intronic
1182855648 22:33515691-33515713 CCTTTTGGGCAGATTAAGTCCGG - Intronic
949472142 3:4407499-4407521 CTTATGGAACACATGGAGTCTGG + Intronic
949526322 3:4908221-4908243 GCTAATGAACAGCTGGAGTCAGG + Intergenic
949528082 3:4925909-4925931 CCTTTTCAACAAATGGTGTTGGG + Intergenic
950243365 3:11392151-11392173 CCTTTAGCACAGATGCAGGCTGG + Intronic
950538708 3:13597107-13597129 TTTTTTGTAGAGATGGAGTCTGG + Intronic
952010693 3:28897626-28897648 CCTTTTTTTGAGATGGAGTCTGG + Intergenic
952326038 3:32321496-32321518 CCTTCACAACAAATGGAGTCTGG - Intronic
953539874 3:43808229-43808251 CCTTTTCAACAAATGGTGTTGGG + Intergenic
955781403 3:62488665-62488687 TATTTTGTAGAGATGGAGTCTGG + Intronic
956229520 3:66998320-66998342 CTTTTTAAATAGCTGGAGTCGGG + Exonic
958087922 3:88836444-88836466 CGTTTTCAACAGATGGTGTTGGG - Intergenic
959188663 3:103081514-103081536 CCTTTTGAACTATTGAAGTCAGG + Intergenic
959541279 3:107541828-107541850 TTTTTTTAAGAGATGGAGTCTGG + Intronic
960092324 3:113653589-113653611 TTTTTTTAATAGATGGAGTCTGG - Exonic
960894624 3:122489599-122489621 CTTTTTGAACACATGGAATATGG + Intronic
961915296 3:130368108-130368130 CCTTTTGAAAAGATGGAACCAGG + Intronic
963156074 3:142098726-142098748 TGTTTTAAAGAGATGGAGTCTGG - Intronic
964029735 3:152123457-152123479 CTTTTTGGAGAGATGGTGTCTGG + Intergenic
967615667 3:191562529-191562551 CCTTCTGAATAAATGGAATCAGG - Intergenic
972526461 4:39917584-39917606 TCTTTTTATGAGATGGAGTCTGG + Intronic
973387279 4:49521077-49521099 CCTTTTCAACACATGATGTCGGG - Intergenic
975308162 4:72872750-72872772 CCTATTTAACAGATGGTGTTGGG + Intergenic
976173668 4:82330727-82330749 CCTTTTGACCTGCTGCAGTCTGG - Intergenic
979852654 4:125592504-125592526 CATTTTGACCAGATTTAGTCAGG - Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981572139 4:146163685-146163707 CCTATTTAACAAATGGTGTCAGG + Intergenic
985048087 4:185961131-185961153 CCTTTTGACCTGATGCAATCTGG - Intergenic
985210645 4:187589392-187589414 TATTTGGAATAGATGGAGTCAGG + Intergenic
985817101 5:2135240-2135262 CCTGGTGAACTGTTGGAGTCTGG + Intergenic
987953303 5:24704308-24704330 CCTTTTGAAGATATGTAGTTTGG - Intergenic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
991065451 5:62419814-62419836 CTTTTTGTAGAGATGGGGTCTGG - Intronic
991916929 5:71614783-71614805 CATTTTTAAAAGATGGGGTCTGG - Intronic
993344249 5:86762840-86762862 CCTTTTTAAAAAATGGAGACAGG - Intergenic
994003620 5:94811421-94811443 CTGTTTGAACAGTTGGAGTTCGG - Intronic
996486495 5:124041746-124041768 TCTTTGGAGAAGATGGAGTCAGG - Intergenic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
1002504066 5:179666641-179666663 TTTTTTGTAAAGATGGAGTCTGG + Intergenic
1002776324 6:330670-330692 ACTTTTGAGAAGATGGACTCAGG + Intronic
1005043258 6:21618485-21618507 TTTTTTTAAGAGATGGAGTCTGG - Intergenic
1005849546 6:29811413-29811435 CCCTGTGAACACAGGGAGTCAGG + Intergenic
1006522508 6:34579474-34579496 CCTTTTTAAGAAATAGAGTCGGG - Intergenic
1006583970 6:35093467-35093489 CCTTTTTAAAAAATGGATTCAGG - Intergenic
1007430713 6:41775158-41775180 CCTTTTGCACAGCTTAAGTCTGG + Intronic
1007891963 6:45303027-45303049 CCTATTGAACAAATGGTGTTGGG + Intronic
1008045202 6:46844728-46844750 CCATTTGACCAGTTGGAGTTTGG - Intergenic
1009949751 6:70381652-70381674 TTTTTTTAAGAGATGGAGTCTGG - Intergenic
1010162074 6:72868453-72868475 CCTATTAACCAGAGGGAGTCTGG + Intronic
1011319200 6:86071355-86071377 CATTTTGAACACATGGACACAGG - Intergenic
1011542344 6:88445354-88445376 CCATCTGGACAGATGGAGTGTGG - Intergenic
1012923149 6:105240488-105240510 CCTTTTCAACAGATGGTGCTGGG + Intergenic
1017190086 6:151643938-151643960 CCTTTTGAACAAATGGTGCTGGG - Intergenic
1017534872 6:155336298-155336320 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1017690515 6:156959496-156959518 CGTTTTGAACAGAATGAGTACGG - Intronic
1019974430 7:4569316-4569338 TTTTTTGAAGAGATGGAGTCTGG + Intergenic
1021219682 7:17961655-17961677 TCTTTTGAATAGATGAAGTATGG - Intergenic
1022220782 7:28311659-28311681 CCTTTAGAAAACAGGGAGTCAGG + Intronic
1022237685 7:28477616-28477638 CCTTTTGATGAATTGGAGTCTGG + Intronic
1022717239 7:32909720-32909742 CCTAAGGAACAGATGGAGTCTGG - Intergenic
1023022030 7:36019265-36019287 TCTTTGGAGCAGATGGAGCCAGG - Intergenic
1023327271 7:39073851-39073873 CCTTTTGAACAGAAGTGGACTGG + Intronic
1023573543 7:41599193-41599215 CTTTTTGTACAGATGGGATCGGG - Intergenic
1027944605 7:84728840-84728862 CATTTTGAACACATGGACACAGG + Intergenic
1030071061 7:105697928-105697950 CCTCTTCCACATATGGAGTCAGG - Intronic
1032430006 7:131852992-131853014 CCTTTTAGATAGAGGGAGTCAGG + Intergenic
1032519511 7:132533412-132533434 CCCTTTGAACAGGTGATGTCTGG - Intronic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1034854202 7:154525324-154525346 TTTTTTGAAGAGACGGAGTCTGG + Intronic
1035855948 8:2976524-2976546 TTTTTTGTAGAGATGGAGTCTGG + Intronic
1036126623 8:6068868-6068890 CATCTTGCACAGTTGGAGTCTGG - Intergenic
1036498264 8:9289854-9289876 CCTTTTCAACAAATGGTGCCGGG - Intergenic
1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG + Intronic
1041746125 8:61211138-61211160 CCTTCTGAACAGTTTCAGTCAGG + Intronic
1041749976 8:61250150-61250172 CCTATTGAATAGATGGTGTTGGG - Intronic
1041913581 8:63116101-63116123 TTTTTTGTACAGATGGGGTCTGG + Intergenic
1042225935 8:66514344-66514366 GTTTTTGAACAGATGGGGACAGG - Intronic
1044944113 8:97375135-97375157 CTTTTTAAACAGAGGGACTCTGG + Intergenic
1046612428 8:116440851-116440873 GATTTTGAACAGCTGGAGGCTGG - Intergenic
1046789649 8:118307371-118307393 CCTTTTGAACAGATAGCTTATGG - Intronic
1049602825 8:143515808-143515830 CCTTTGGAAGGGATGGAGACTGG + Intronic
1049954639 9:681034-681056 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1050507829 9:6365877-6365899 CCTGATTCACAGATGGAGTCAGG + Intergenic
1051800160 9:20923648-20923670 CCTTTTGAACAGGGAGAGTCCGG + Exonic
1053652363 9:40182011-40182033 CCATTTGACCAGTTGGAGTTTGG + Intergenic
1053753123 9:41275308-41275330 CCTTTTCAACACATGAAGTTGGG - Intergenic
1053902759 9:42811323-42811345 CCATTTGACCAGTTGGAGTTTGG + Intergenic
1054258648 9:62839670-62839692 CCTTTTCAACACATGAAGTTGGG - Intergenic
1054333125 9:63780384-63780406 CCTTTTCAACACATGAAGTTGGG + Intergenic
1054532219 9:66194204-66194226 CCATTTGACCAGTTGGAGTTTGG - Intergenic
1054889805 9:70238905-70238927 CCTATTTAACAAATGGTGTCGGG + Intergenic
1056323111 9:85455449-85455471 CCTAAGGAACAGATAGAGTCTGG - Intergenic
1057144701 9:92749897-92749919 CGTTTGGAACAGATGCCGTCTGG - Intronic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1059751626 9:117253220-117253242 CCCTTTGAACAAATGGACCCAGG - Intronic
1060344833 9:122806955-122806977 CCTTTTTCACCGATGCAGTCTGG + Intronic
1188412020 X:29884688-29884710 GATTTTGAACATATGGAGTTTGG - Intronic
1190234218 X:48603634-48603656 TTTTTTTAAGAGATGGAGTCTGG - Intronic
1191778058 X:64839846-64839868 CCTTTTGAACAAATGGTGCTAGG - Intergenic
1192232238 X:69273297-69273319 GCTGATGAAGAGATGGAGTCTGG - Intergenic
1192820642 X:74641593-74641615 CCTTTTCAACAAATGGTGTTGGG + Intergenic
1193325443 X:80174614-80174636 CCTTTTCAACAAATGGTGTGGGG - Intergenic
1193784969 X:85749853-85749875 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1194514284 X:94830955-94830977 GCTTTTGAAGAGATTGAGTATGG - Intergenic
1195686703 X:107593627-107593649 CCTTTTCAACAAATGGTGTTGGG - Intronic
1196189841 X:112782775-112782797 CATTTGGAACAGATGGTTTCTGG + Intronic
1196521938 X:116684332-116684354 TCTTTTCAACAAATGGTGTCTGG - Intergenic
1197475922 X:126925204-126925226 CCTTTTCAACAAATGGTGCCGGG - Intergenic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1198234801 X:134726847-134726869 CCTGGTGAAAATATGGAGTCAGG + Intronic
1198463556 X:136884925-136884947 CCTTTTTAAGAGGTGGAGTAAGG + Intergenic