ID: 1070112527

View in Genome Browser
Species Human (GRCh38)
Location 10:73498877-73498899
Sequence CAGGATGAACAATGGGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070112518_1070112527 15 Left 1070112518 10:73498839-73498861 CCTCAGGGGTACATGAAGACTGC 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG 0: 1
1: 0
2: 2
3: 35
4: 408
1070112517_1070112527 24 Left 1070112517 10:73498830-73498852 CCAAGCTGACCTCAGGGGTACAT 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG 0: 1
1: 0
2: 2
3: 35
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070112527 Original CRISPR CAGGATGAACAATGGGAGGG TGG Exonic
900414441 1:2528565-2528587 CCGGAAGAACAGGGGGAGGGAGG - Intergenic
900878130 1:5360598-5360620 CAGGATTATCATGGGGAGGGAGG + Intergenic
901198999 1:7456183-7456205 AGGGAGGAAAAATGGGAGGGAGG + Intronic
901199151 1:7456997-7457019 AGGGAGGAAGAATGGGAGGGAGG - Intronic
902279615 1:15364898-15364920 CAGGATGGTTGATGGGAGGGAGG - Intronic
903156404 1:21446551-21446573 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
904375846 1:30081983-30082005 GAGGAGGAACAAGAGGAGGGAGG - Intergenic
904941211 1:34165869-34165891 CAGGGTTAAGAATTGGAGGGCGG + Intergenic
907272595 1:53299581-53299603 CTGGATGACCAATGTGAGGCTGG - Intronic
907893180 1:58656093-58656115 CAGGAAGAGAAATGGGAGGAAGG + Exonic
908171604 1:61510719-61510741 CAGGATGCCCCATGAGAGGGCGG + Intergenic
909869317 1:80719138-80719160 AAGGAGGAAGAATGGAAGGGAGG - Intergenic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
911585196 1:99682353-99682375 AGGGATAAAGAATGGGAGGGAGG + Intronic
912285548 1:108364854-108364876 CAGGATGAGGAATGGGAGGAAGG + Intergenic
912559426 1:110539299-110539321 CAGGCTGACCAATAGGAGGAAGG + Intergenic
913960883 1:143337487-143337509 AAGGATGGGCAAGGGGAGGGGGG - Intergenic
914055237 1:144163059-144163081 AAGGATGGGCAAGGGGAGGGGGG - Intergenic
914123909 1:144803302-144803324 AAGGATGGGCAAGGGGAGGGGGG + Intergenic
915978795 1:160407726-160407748 GAGGGTGGACAATGGGAGGTGGG - Intronic
917111799 1:171556358-171556380 CAGGAAGCACAAGGGGTGGGGGG - Intronic
917529785 1:175824300-175824322 CAGGATGAATAAGGGCATGGAGG - Intergenic
919823929 1:201490493-201490515 CGGGATGGCCAATGGGTGGGAGG + Intronic
919847235 1:201649676-201649698 GAGGCTGGACAATGGGATGGGGG + Intronic
919849819 1:201665113-201665135 AAGGAAGAACCATGGGTGGGAGG - Intronic
920040870 1:203095642-203095664 TAGGATGAAGAATGGGAGGTGGG + Intronic
920222866 1:204416925-204416947 AAGGAAGAAGAAAGGGAGGGAGG + Intergenic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920945196 1:210522522-210522544 CAGGAGCAACGATGGAAGGGGGG - Intronic
921287012 1:213617902-213617924 CAGAATGAAAAATGTGAGAGGGG + Intergenic
921430759 1:215063106-215063128 GAGAATGAAGAATGGGAGAGTGG + Intronic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
1065202441 10:23326696-23326718 CAGCATAAAAGATGGGAGGGTGG + Intronic
1066044942 10:31586752-31586774 CAGGATGCAGAGTGAGAGGGTGG + Intergenic
1067029321 10:42869888-42869910 AAGGATGGGCAAGGGGAGGGGGG - Intergenic
1068275691 10:54792853-54792875 CAGGTTGAGCACTGGCAGGGTGG + Intronic
1068606970 10:59016231-59016253 AAGGATGAAGAATGGGGGTGGGG + Intergenic
1068873691 10:61973606-61973628 CAGTGTAAAAAATGGGAGGGGGG + Intronic
1069910430 10:71755498-71755520 CAGGAGGAGCAATGGGAATGGGG - Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070788838 10:79177856-79177878 CAGGATGACCTCTGGGTGGGAGG - Intronic
1070895630 10:79981597-79981619 GAGGACGAAGAATGGGAGGGAGG - Intronic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073750038 10:106515022-106515044 TAGGATCACCAAGGGGAGGGCGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074154008 10:110782742-110782764 CAGGATGAGAGATGGGAGGCAGG - Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1075000199 10:118791205-118791227 CAGGAAGAAGGGTGGGAGGGGGG + Intergenic
1075724271 10:124603623-124603645 CAGGTTGGGCAAGGGGAGGGCGG + Intronic
1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG + Intergenic
1077353415 11:2103548-2103570 CAGGAAGCCCACTGGGAGGGTGG - Intergenic
1078388441 11:10913627-10913649 CAGGAAGGAAAAAGGGAGGGAGG - Intergenic
1081626456 11:44658868-44658890 ATGGATGAAGGATGGGAGGGTGG + Intergenic
1083756972 11:64797013-64797035 CAGGATGACCTCTGGGAGGGAGG + Exonic
1083803518 11:65060019-65060041 CAGGATAGGCCATGGGAGGGTGG - Intergenic
1083832508 11:65241802-65241824 CTGGAGGAACAATAGGAGGGTGG + Intergenic
1083896870 11:65624459-65624481 CAGGGTGAACACTGGCAGGGAGG - Exonic
1084234093 11:67775192-67775214 CGGGATGAACGCTGGGAGAGAGG + Intergenic
1084768017 11:71325002-71325024 CAGCAGGAGCGATGGGAGGGTGG + Intergenic
1084797367 11:71517275-71517297 CATTATGAAAACTGGGAGGGAGG + Intronic
1085084130 11:73655541-73655563 CAGGATGAAATAGGGGAGGGTGG + Intronic
1088471167 11:110188503-110188525 TAGGAGGAAGGATGGGAGGGGGG + Intronic
1090036120 11:123251150-123251172 CAGGATGGACTAGGGGAGTGCGG + Intergenic
1090424645 11:126598946-126598968 CTGGCCAAACAATGGGAGGGAGG - Intronic
1090752640 11:129760649-129760671 CAGGAAAGACAATGGGATGGTGG + Intergenic
1091782866 12:3224923-3224945 CGGGATGAGCCATGGGAGCGTGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1092791680 12:12076088-12076110 CAGGATGGATGAGGGGAGGGTGG + Intronic
1093058399 12:14578104-14578126 CAAGATGAACAATAAGAGGATGG - Intergenic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093880293 12:24396491-24396513 CAGCATGAACAATGGGAACCGGG - Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095940815 12:47725561-47725583 CAGGAAGAAAAAGGGGAGGGAGG + Intronic
1096428023 12:51520750-51520772 CAGGATGAGAGATGGGAGGGTGG + Intergenic
1096744274 12:53715338-53715360 CAAGAAGGAAAATGGGAGGGTGG + Intronic
1097071595 12:56359159-56359181 CAGCAGGAACAAGGGAAGGGAGG + Intronic
1097763590 12:63497360-63497382 CAGGATGGAGGATGGGAGGAAGG + Intergenic
1098475903 12:70902729-70902751 CAGGGAGAAGAGTGGGAGGGGGG + Intronic
1098760002 12:74411383-74411405 CAGGAGGAAAGAGGGGAGGGAGG + Intergenic
1099217919 12:79876182-79876204 CAGGATATAAAATGGTAGGGAGG - Intronic
1099364989 12:81758180-81758202 CAGGATGAACAATTTTAGTGTGG - Intronic
1099516951 12:83608693-83608715 TAGGGTGAAGACTGGGAGGGGGG + Intergenic
1100609649 12:96180744-96180766 CAGAATGAAAAATGGGGGGTGGG + Intergenic
1100955527 12:99903732-99903754 CCGGAGGAAAAATGGGAGGGGGG + Intronic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102856115 12:116295534-116295556 GAGGATGAAGGATGGGTGGGTGG + Intergenic
1103454644 12:121055400-121055422 CAGGATGGAGGAGGGGAGGGAGG - Intergenic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1103688537 12:122752148-122752170 AAGGATGAAGGAAGGGAGGGAGG + Intergenic
1106075731 13:26459379-26459401 CAGGATGAGCAATGAGAGTGTGG - Intergenic
1106343978 13:28858450-28858472 GTGGATGAAGAATGGGAGGAAGG - Intronic
1106355482 13:28978444-28978466 CAGGAAGAAGAATGAGAAGGGGG + Intronic
1106511325 13:30415281-30415303 GAGGAAGAAGAAAGGGAGGGAGG - Intergenic
1108088041 13:46816663-46816685 CAGAGTGAACAATGTGAGGCAGG - Intergenic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1109468051 13:62764554-62764576 GAGGATGAAGACTGGGAGGGAGG + Intergenic
1109815117 13:67571690-67571712 TAGGATTAAAAATGGGAGGAGGG + Intergenic
1110744433 13:79036379-79036401 AAGGAAGAAAAAAGGGAGGGAGG + Intergenic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1110997107 13:82124178-82124200 TGGGAAGAATAATGGGAGGGTGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112013009 13:95307829-95307851 CAGGCCGAAAAATGAGAGGGAGG - Intergenic
1113106334 13:106775377-106775399 AAGAGTGAACAATGGGTGGGTGG - Intergenic
1115305513 14:31929916-31929938 AAGGCTGAACAATTGCAGGGAGG - Intergenic
1115426389 14:33264901-33264923 CAGGAAGAATAATGGAAGTGGGG - Intronic
1115454753 14:33589271-33589293 GACCATGAAAAATGGGAGGGAGG + Intronic
1116644147 14:47504887-47504909 CTGAATGAACCATGGGAGTGTGG - Intronic
1116866950 14:50039016-50039038 CAGGAGGAGCTCTGGGAGGGCGG + Intergenic
1117049622 14:51847175-51847197 CAGGCTGCAGACTGGGAGGGTGG + Intronic
1117192712 14:53308935-53308957 CAGGGTGAAGCGTGGGAGGGGGG - Intergenic
1117343670 14:54812624-54812646 CAGGATGAAGGAAGGGAAGGAGG - Intergenic
1118045188 14:61962116-61962138 GAGGATGGAGAATGGGAGGAGGG + Intergenic
1118055697 14:62077453-62077475 CAGGAAAGACAATGGGAGTGTGG + Intronic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1119118671 14:72052378-72052400 CATTATGAAAAGTGGGAGGGGGG - Intronic
1120290471 14:82563659-82563681 GAGGAAGAAGAGTGGGAGGGAGG + Intergenic
1120738965 14:88086695-88086717 GAGGATGGAGAATGGGAGGAGGG - Intergenic
1121026609 14:90620916-90620938 CAGGAAGAACAATGGTAGAGTGG + Intronic
1121438628 14:93934961-93934983 AGGGGTGAACAATGGGAAGGTGG - Intronic
1122012160 14:98759182-98759204 GAGGAGGAAGAAAGGGAGGGAGG - Intergenic
1122039871 14:98979556-98979578 CAGGAGGAAGAAAGTGAGGGGGG - Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1125785325 15:42311645-42311667 CAGGAGGAATAAAGAGAGGGAGG + Intronic
1127070976 15:55288597-55288619 AAGGAAGAAAAAAGGGAGGGAGG + Intronic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1127619804 15:60722830-60722852 AAGGATGAGAAATGGGAAGGAGG - Intronic
1127749180 15:62016153-62016175 GAGGAAGAAGAATGGTAGGGTGG - Intronic
1128363880 15:66982993-66983015 CAGGATGAAGCATTGGAAGGAGG - Intergenic
1128589078 15:68878596-68878618 CAGGAGGAAGGTTGGGAGGGGGG - Intronic
1129262682 15:74377456-74377478 CAGGCTTAACCATGGGAGGAGGG - Intergenic
1129483953 15:75850607-75850629 GAGGAGGAAAGATGGGAGGGAGG + Intronic
1129605269 15:77021882-77021904 CAGGATGAGCAATAGGGGAGTGG - Intronic
1129697893 15:77750994-77751016 CAGGAAGAACAAGGGCAGCGTGG + Intronic
1130080030 15:80724782-80724804 CAGAATGAATAATAGGAGGAGGG - Intronic
1130536851 15:84791874-84791896 CAGGATGAATTGTGGGAGTGGGG + Intronic
1131569813 15:93523477-93523499 CAGCATGCCCAATGGGATGGGGG - Intergenic
1131929858 15:97429731-97429753 CAGGAGCAAGAAGGGGAGGGAGG - Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133363898 16:5195961-5195983 CAGGATGAAACAAGGGTGGGTGG + Intergenic
1133392701 16:5422596-5422618 CAGGAGGAAGAGTGAGAGGGTGG + Intergenic
1133417023 16:5614890-5614912 GAGGAAGAACACAGGGAGGGTGG + Intergenic
1134138462 16:11696360-11696382 CAGGAGGAACCAGAGGAGGGAGG - Intronic
1134771548 16:16813587-16813609 GAGGATGAGGAATGGGAGGAGGG - Intergenic
1134771557 16:16813611-16813633 GAGGATGAGGAATGGGAGGAGGG - Intergenic
1135250917 16:20900449-20900471 CAGGAGGGAGAATGGGAGAGGGG + Intronic
1135892655 16:26371497-26371519 AAGGAAGAAGAAAGGGAGGGAGG + Intergenic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1137591478 16:49696662-49696684 CAGGCTGCACAATGAGGGGGAGG - Intronic
1138434378 16:56989127-56989149 CAGGATGAACTAGGGGAGAAGGG - Intergenic
1138621240 16:58212957-58212979 GAGGAGGAAGAAAGGGAGGGAGG + Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1140730569 16:77852309-77852331 CAGGATCAAGGGTGGGAGGGAGG - Intronic
1140862176 16:79027432-79027454 CAGGGTGTAAAATGGGAGGCAGG - Intronic
1140900540 16:79363182-79363204 AAAGATGAACAAGGGTAGGGGGG + Intergenic
1141045979 16:80716474-80716496 CTGGATGAACAATGGGTGGGTGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141514555 16:84535083-84535105 AAGGAGGAAGAAGGGGAGGGAGG - Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142544307 17:688509-688531 CAGGATGAAGAATGGTAGTGAGG + Intronic
1143181368 17:4986390-4986412 AAGGATGAGGAAAGGGAGGGAGG + Intronic
1143927709 17:10387289-10387311 CAGGAGGAAATTTGGGAGGGGGG - Intergenic
1144440677 17:15278444-15278466 CAGGAGGAACATTGGAAGGTAGG - Intergenic
1145769190 17:27480125-27480147 CAGGATGAGCAATGGGGTGAAGG - Intronic
1146621064 17:34398351-34398373 CAGGAGGAACCATGGGGGTGTGG + Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146785860 17:35720776-35720798 CAGGATGAAGAATAGGAAAGAGG - Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147419306 17:40314266-40314288 CAGGAGGGAAATTGGGAGGGTGG - Intronic
1147553995 17:41464750-41464772 CAGGATGAACACAGGTGGGGAGG - Intronic
1147599738 17:41738490-41738512 ATGGATGCACACTGGGAGGGAGG - Intergenic
1148055926 17:44795584-44795606 CAGGGTGTGCAATGGGAGAGTGG + Intergenic
1148783754 17:50135276-50135298 GAGGGAGGACAATGGGAGGGGGG + Exonic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149538381 17:57450174-57450196 CAAAATGAAAAATGAGAGGGAGG + Intronic
1149754316 17:59174885-59174907 GAGGCTGGACAAGGGGAGGGAGG - Intronic
1150137236 17:62702825-62702847 CAGGATGGACGAGGGGATGGGGG - Intronic
1150245394 17:63670849-63670871 CAGGATGAAGCTGGGGAGGGAGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1152344546 17:79743139-79743161 CAGGAAGAACAATTGGATTGTGG - Intergenic
1153246017 18:3073373-3073395 CAGGCCGAAAAATGAGAGGGAGG - Intronic
1153437212 18:5080208-5080230 CAGAATGAACAATGTGAGCATGG + Intergenic
1153505483 18:5792665-5792687 GAGGATGAAGAGTGGGAGGAGGG + Intergenic
1155280078 18:24230231-24230253 CAGGACAAACAAGGAGAGGGAGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156625008 18:38898186-38898208 CAGGAAGAAGAATCTGAGGGAGG + Intergenic
1157116572 18:44867723-44867745 CAGGATGGGGAATGGGGGGGTGG + Intronic
1157301670 18:46483988-46484010 CAGGATGGAGATGGGGAGGGTGG + Intronic
1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG + Intronic
1157877980 18:51291514-51291536 AAGGAAGGAAAATGGGAGGGAGG - Intergenic
1158005966 18:52672574-52672596 TAGGAAGAAGAAAGGGAGGGAGG - Intronic
1158432044 18:57398034-57398056 AAGAAAGAACAAAGGGAGGGAGG + Intergenic
1158814807 18:61083000-61083022 CAGGAATGACAATAGGAGGGAGG - Intergenic
1158860783 18:61590190-61590212 GGGGATGAAGAAGGGGAGGGAGG - Intergenic
1159572120 18:70127638-70127660 CAGCCTGAACAATGGAATGGAGG + Exonic
1159703676 18:71660685-71660707 AAGAATAAACAATGGGAGAGAGG - Intergenic
1160596034 18:79975023-79975045 CAGCATGGAGAATGAGAGGGCGG - Intronic
1163136817 19:15317583-15317605 TAAGGTGAACAATGGGAGTGGGG + Intronic
1163758102 19:19118944-19118966 CAGTTTGAGGAATGGGAGGGCGG - Intergenic
1164704788 19:30312279-30312301 CAGGATGAACAGAGGGGGCGGGG + Intronic
1165013045 19:32862576-32862598 CGAGATGAACACTGGAAGGGTGG + Exonic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166782471 19:45349676-45349698 CAGGGTGAGCAACGTGAGGGTGG + Intronic
1166960511 19:46493674-46493696 CAGGAAGAAGAAGGGGAGCGCGG - Exonic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167616225 19:50535760-50535782 CAGGAGGATGAATGGGAGGAGGG - Intronic
1168493979 19:56835173-56835195 CAGGGTGCAGAAGGGGAGGGTGG - Intronic
1202694719 1_KI270712v1_random:115736-115758 AAGGATGGGCAAGGGGAGGGGGG - Intergenic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
926157865 2:10467628-10467650 CAGAAGGAACACTGGGCGGGAGG + Intergenic
926242578 2:11099944-11099966 CAGGAAGACAAATGGGAGGACGG - Intergenic
926988548 2:18651331-18651353 CAGAATGAACCATAGGATGGCGG - Intergenic
928361784 2:30668992-30669014 TAGCATAAAGAATGGGAGGGAGG - Intergenic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929821118 2:45274503-45274525 GAGGCTGAAGAATGGCAGGGAGG + Intergenic
930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG + Intergenic
931673376 2:64669544-64669566 CAGGATGAACAAAGATAGGGAGG + Intronic
932688694 2:73894476-73894498 CAGAATGAACAAGGGGAAAGAGG - Intronic
933481362 2:82861154-82861176 AAGGCTGAAAAATGGGAAGGAGG - Intergenic
934275890 2:91572784-91572806 AAGGATGGGCAAGGGGAGGGGGG - Intergenic
934319640 2:91960707-91960729 AAGGAAGAAAAAAGGGAGGGAGG - Intergenic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
940803434 2:158157682-158157704 CAGGGAGAACACTGGGAGTGGGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941881908 2:170489361-170489383 GAGGAGGAACAATGGGATTGGGG + Intronic
942069023 2:172298648-172298670 CAGGGTGGAGAATGGGAGAGAGG + Intergenic
942947540 2:181685631-181685653 AAGGAGGAAGAAGGGGAGGGAGG - Intergenic
943557645 2:189425805-189425827 CAGGACCAAGAATGGGAGGGAGG - Intergenic
945491000 2:210455126-210455148 CAAGATGAACAATGAGAAGCAGG - Exonic
945787321 2:214258238-214258260 CGGGAAGAAGAGTGGGAGGGGGG - Intronic
945916543 2:215710542-215710564 CATGTTGGAAAATGGGAGGGAGG + Intergenic
947327295 2:228992560-228992582 CATGAACAGCAATGGGAGGGAGG - Intronic
947483548 2:230525620-230525642 CAGGAAGCACAAGGGGTGGGGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948146928 2:235715195-235715217 AAGGAAGAAGGATGGGAGGGAGG - Intronic
1169166909 20:3431919-3431941 CTGGATGAACAAGGAGAGGTGGG + Intergenic
1170350233 20:15432459-15432481 CAGGATGAGCACTGGGCTGGAGG + Intronic
1170533724 20:17319668-17319690 GGGGGTGAACACTGGGAGGGGGG + Intronic
1172114999 20:32568529-32568551 CAGGAAGAACATGGGGAGGGAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172428400 20:34871804-34871826 AAGGATGAAGAATGGAGGGGAGG + Intronic
1172439495 20:34955660-34955682 CGGGAGGAACGATGTGAGGGAGG - Intronic
1172639278 20:36431320-36431342 CATGATGAAATATGGGTGGGGGG - Intronic
1172780886 20:37436401-37436423 GGGGATGAATAATGGGAGGATGG - Intergenic
1173530651 20:43766869-43766891 CAGTATGAACAAAGACAGGGAGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1175059631 20:56230374-56230396 AAGGAAGAAAAAAGGGAGGGAGG + Intergenic
1175364174 20:58440098-58440120 CAGGATGTACACTGGGAAGAGGG - Intronic
1178244423 21:30936896-30936918 CGGGATGACCAATGGCAGAGAGG + Intergenic
1178420288 21:32437771-32437793 CGAGATGAACACTGGGAGAGAGG - Intronic
1178586992 21:33879045-33879067 CAGGATGAAGCATTGGAGGCAGG + Intronic
1179298467 21:40084413-40084435 CAGGATGGAAAAGGGGAAGGAGG + Intronic
1179509292 21:41861852-41861874 CAGAAATAACAAGGGGAGGGGGG + Intronic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1181455250 22:23055879-23055901 CATGGAGAACAGTGGGAGGGAGG + Intergenic
1182168325 22:28199828-28199850 CTGGAGGAAAAATGGGAGAGGGG + Intronic
1182444993 22:30384776-30384798 CAGGCTGAAAAATGGGTGAGGGG - Intronic
1182698119 22:32209903-32209925 GGGACTGAACAATGGGAGGGAGG - Intergenic
1182916571 22:34038349-34038371 CAGGAGGAAAAAAGGGAGAGAGG - Intergenic
1183921863 22:41176291-41176313 CAGGATCAACAATGGGAGGCAGG - Exonic
1184335660 22:43851680-43851702 CAGGCTGCACACTTGGAGGGTGG - Intronic
1184744613 22:46449098-46449120 GTGGATGAACAATGGATGGGTGG - Intronic
952191290 3:31025957-31025979 CATGATGAACAATGGGGAGGGGG - Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953753779 3:45629859-45629881 CAGGGTGTGCAATGGGAGTGTGG - Intronic
954622400 3:52003610-52003632 CAGGAACACCAATGGTAGGGAGG - Intergenic
954671707 3:52294489-52294511 CAGGCTGGAGATTGGGAGGGAGG + Intergenic
956105982 3:65819421-65819443 TAGGATGACCAATGTGAGGGTGG - Intronic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956873820 3:73442974-73442996 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
957321424 3:78635869-78635891 CAACATGAACAATGGCAGCGGGG - Exonic
957373645 3:79328794-79328816 CTGGGTGAAAGATGGGAGGGGGG - Intronic
959073041 3:101721099-101721121 TAGGATGAACGGTGGGAGGTAGG + Intergenic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
960890495 3:122443011-122443033 CAGGAAGCACAATGGGTCGGGGG + Intronic
960937263 3:122911796-122911818 CAGGATGAAACATGGAAGTGGGG - Intronic
960980746 3:123223030-123223052 AATTATGAACCATGGGAGGGGGG - Intronic
961658981 3:128458360-128458382 CAGGATGAAAGAGGGAAGGGAGG + Intergenic
961664881 3:128488849-128488871 CAGTCTGTACAATGGGAGGGAGG - Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962285837 3:134084973-134084995 CAGCATGAACAAGGAGAGTGAGG + Intronic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964040211 3:152252284-152252306 AGGGAGGAACAAAGGGAGGGAGG - Intronic
964506488 3:157405545-157405567 TAGGATGAATAATGGAGGGGAGG - Intronic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
967403916 3:189095278-189095300 AATGATGAACAAAGGGAGAGTGG + Intronic
967597950 3:191349970-191349992 CAGGAAAAAAAAAGGGAGGGGGG - Intronic
967746833 3:193065696-193065718 CAGGAGGAAAGAAGGGAGGGAGG + Intergenic
968633546 4:1665816-1665838 AGAGATGAAGAATGGGAGGGAGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969586465 4:8097014-8097036 CAGGAGGAAGAAGGGAAGGGAGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
969821054 4:9720568-9720590 CAAGATGAACGCTGGGAGAGAGG - Intergenic
970590728 4:17558162-17558184 GAGGATGAAGGATGGGAGGAGGG + Intergenic
970792649 4:19876783-19876805 AAGGAAGAAAAGTGGGAGGGAGG + Intergenic
971769595 4:30879166-30879188 AAGGAGGAATAAAGGGAGGGAGG - Intronic
973628102 4:52792679-52792701 CAGGATGAACACTGGAAAGATGG + Intergenic
973697587 4:53505892-53505914 CAGGCTGGATAATGGAAGGGAGG + Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
974552649 4:63398142-63398164 AAGGGTGGAGAATGGGAGGGGGG - Intergenic
975129525 4:70818742-70818764 CAGGAAGAATAGTGGGAGTGGGG - Exonic
976975905 4:91165866-91165888 CAGGAAGCACAATGGGTTGGGGG - Intronic
977287693 4:95129391-95129413 GAGGAAGAAAAAAGGGAGGGAGG - Intronic
977840206 4:101693945-101693967 CAGGAATAATAAAGGGAGGGAGG - Intronic
979289781 4:118966725-118966747 CAGGAGGAACTAGGGGAGGGGGG - Intronic
980279908 4:130706182-130706204 TAGGTTGAACAATGAGAGGTAGG - Intergenic
981595526 4:146417254-146417276 CAGGATGAAGCTTGAGAGGGAGG + Intronic
982426175 4:155264122-155264144 GAGGATGGAGAATGGGAGGAGGG - Intergenic
982596726 4:157395042-157395064 AAGGAAGAAAGATGGGAGGGAGG + Intergenic
983691038 4:170469559-170469581 AAGGAAGGAAAATGGGAGGGAGG - Intergenic
983804927 4:171982999-171983021 AAGGAGGAAAAAAGGGAGGGAGG - Intronic
984403525 4:179297620-179297642 GAGGATGAAGGATGGGAGGAGGG + Intergenic
985844559 5:2334692-2334714 CAGAAAGAACAATGGAGGGGAGG - Intergenic
985932455 5:3069169-3069191 CAGGCAGAACCAAGGGAGGGAGG - Intergenic
986313611 5:6571827-6571849 AAGGAGGAAGAAAGGGAGGGAGG + Intergenic
987331416 5:16860741-16860763 CGTGATGAACGATGGGTGGGTGG + Intronic
989249464 5:39292735-39292757 TAGCATTAAAAATGGGAGGGAGG + Intronic
993305598 5:86271576-86271598 CAGGATGAGGAATGGGAGGAAGG + Intergenic
994581494 5:101648438-101648460 CAGGCTGCACAATAGGAGGTGGG - Intergenic
995584467 5:113633311-113633333 CAGGATGAAGAATTGGCTGGAGG + Intergenic
997081977 5:130749800-130749822 CAGAATGAATAATGGGGTGGGGG + Intergenic
997476306 5:134144547-134144569 CAGTGGGAAGAATGGGAGGGAGG - Intronic
997825264 5:137100617-137100639 CAGGCTGTACAATGGCAGGCAGG - Intronic
1003062931 6:2876422-2876444 CAGTCTGCACAAGGGGAGGGAGG + Intergenic
1003869255 6:10389029-10389051 CATGATGATCAAGGGGAGGAAGG - Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1006121555 6:31809778-31809800 CAGGAAGAAGAATGTTAGGGTGG + Exonic
1007528404 6:42517885-42517907 CAGCATGAAGAATGGGAGGAAGG - Intergenic
1007827126 6:44608890-44608912 CAGGAAGGAGAAAGGGAGGGAGG - Intergenic
1009292919 6:61906543-61906565 CAGGAAGAATAGTGGGAAGGAGG - Intronic
1010171848 6:72984646-72984668 CAGGAAGCACAAGGGGTGGGGGG - Intronic
1011037414 6:82992759-82992781 CAGGTTCAACAATGAGAGGCTGG + Intronic
1011823047 6:91275057-91275079 CAGGGTGGAAAATGTGAGGGCGG + Intergenic
1013037725 6:106402834-106402856 CAGGATGAGTGAGGGGAGGGTGG + Intergenic
1013175796 6:107675413-107675435 CGGGAAGAACAATAGGAGGTGGG + Intergenic
1013788328 6:113807982-113808004 GAGGGTTAAGAATGGGAGGGAGG + Intergenic
1016294110 6:142555492-142555514 CATGAGGAACAATGGGACAGAGG + Intergenic
1016510473 6:144837159-144837181 CAGAAGGAAGAAAGGGAGGGAGG - Intronic
1016882760 6:148927209-148927231 GAGGAGGACCAGTGGGAGGGAGG + Intronic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1018323046 6:162633783-162633805 CAGGATGAAGCGAGGGAGGGAGG + Intronic
1019131766 6:169882221-169882243 CATGCTGGACAACGGGAGGGCGG + Intergenic
1019296362 7:277644-277666 CAGGATGAGACATGGGAGGTGGG + Intergenic
1019414956 7:922862-922884 CAGGATAGACAATGGGGGCGGGG - Intronic
1021550653 7:21867945-21867967 CAGGATGAAGAATATGGGGGTGG - Exonic
1022363560 7:29685750-29685772 GAGGACGAAGAATGGGAGGGAGG + Intergenic
1022644177 7:32215543-32215565 CATGGAGACCAATGGGAGGGAGG + Intronic
1022697816 7:32727994-32728016 GAGGACGAAGAATGAGAGGGAGG - Intergenic
1023004248 7:35846276-35846298 CAGGTCCAACAATGGGAGGCAGG - Intronic
1024004348 7:45214486-45214508 CAGGAGGAAAAAATGGAGGGAGG + Intergenic
1025192264 7:56904933-56904955 GATGATGAAAAATGGGAGTGAGG - Intergenic
1025219354 7:57092509-57092531 CAGGTGCAACAATGGGAGGTAGG + Intergenic
1025630146 7:63264080-63264102 CAGGTGCAACAATGGGAGGTAGG + Intergenic
1025652124 7:63479955-63479977 CAGGTGCAACAATGGGAGGTAGG - Intergenic
1025679684 7:63671999-63672021 GATGATGAAAAATGGGAGTGAGG + Intergenic
1029615964 7:101657343-101657365 GATGAAGAGCAATGGGAGGGAGG + Intergenic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1031014453 7:116558026-116558048 GAGGAAGAACAATGGGACGTTGG - Intronic
1031030639 7:116730569-116730591 TAGGATGAAAATTGGGAGGAAGG + Intronic
1031871237 7:127091656-127091678 GAGGATGATCAGTGGGATGGTGG - Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1031995269 7:128226491-128226513 AAGGATGGACAATAGGAGGATGG - Intergenic
1031995274 7:128226514-128226536 AAGGATGGACAATAGGAGGATGG - Intergenic
1032095396 7:128935647-128935669 CAAGATGGACAGTGGGAAGGGGG + Intergenic
1032803288 7:135333614-135333636 CAGGATGGACAATGTGAGGCTGG + Intergenic
1033362042 7:140644701-140644723 AAGGTTGAAGAATGGGAGGCAGG + Intronic
1034196528 7:149252609-149252631 CAAGATGACCAATGGCAGGGAGG - Intronic
1034301993 7:150024307-150024329 CAGGAGGACCCACGGGAGGGTGG + Intergenic
1034855785 7:154545428-154545450 AAGGATGAAGAAAAGGAGGGAGG - Intronic
1034869618 7:154672493-154672515 CAGCATGAAGAATTGGATGGTGG + Intronic
1035236457 7:157500707-157500729 CGGGGAGAACAAGGGGAGGGAGG - Intergenic
1035289707 7:157830060-157830082 CAGAAAGGACAGTGGGAGGGAGG - Intronic
1035784418 8:2249731-2249753 GAGGATGAACCAGGGGAAGGTGG + Intergenic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1036017727 8:4804546-4804568 AGGGAGGAACACTGGGAGGGAGG + Intronic
1036487231 8:9190229-9190251 AAGGATGGAGGATGGGAGGGAGG - Intergenic
1036777071 8:11620820-11620842 GAGGATGAAATAGGGGAGGGAGG - Intergenic
1037569037 8:20142933-20142955 CAGGATGATGAATGGGTGGCAGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037806245 8:22059227-22059249 CAGGAGGAAGAAAGGGAGAGAGG + Exonic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1039321237 8:36434393-36434415 AAGGAGGAAGAAAGGGAGGGTGG + Intergenic
1041781923 8:61586132-61586154 AAGGAAGAACACTGGGAGAGTGG - Intronic
1043359998 8:79461096-79461118 CAGGATGTGCATTGTGAGGGAGG - Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1047008235 8:120643417-120643439 CAGGAGGAAGGGTGGGAGGGTGG - Intronic
1047171409 8:122496625-122496647 GAGGATGAAGAATGTGAGGAGGG + Intergenic
1048013767 8:130479902-130479924 CAGGATCAAGAGTGTGAGGGGGG + Intergenic
1048436083 8:134419164-134419186 GAGGATGGACAGTGGGAGGAGGG + Intergenic
1048437128 8:134428710-134428732 CAGGATCCAAAATGGGTGGGAGG + Intergenic
1049733213 8:144189706-144189728 CAGGGAGAACAATGGCAGGGCGG - Intronic
1049880460 8:145058615-145058637 CAGGATCAACAATGGGCTGTGGG - Intergenic
1051576330 9:18620119-18620141 CAGAGTTAACAATGGAAGGGAGG - Intronic
1051614810 9:18997152-18997174 CAGGAAGAACAAGGGGTTGGGGG + Intronic
1052469019 9:28869424-28869446 GAGGATGAACAAGGAGTGGGGGG + Intergenic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1052894196 9:33731924-33731946 CAGGAAAGACAATGGGATGGTGG + Intergenic
1054261885 9:62875127-62875149 CAGCTTGAACTAAGGGAGGGAGG - Intergenic
1054442727 9:65282242-65282264 CAGGATCATAAATGGAAGGGAGG - Exonic
1056262366 9:84861926-84861948 CAGGATGAACAAGCATAGGGTGG - Intronic
1057519803 9:95751829-95751851 CAGGAGGGAGGATGGGAGGGAGG + Intergenic
1057893457 9:98887319-98887341 AGAGATGAACAATGGGAGAGGGG - Intergenic
1058429444 9:104905043-104905065 GAAGATGAAAAATGGAAGGGAGG + Intronic
1059140365 9:111847375-111847397 CAGCATGGACAATGGAATGGAGG + Intergenic
1061105008 9:128523257-128523279 CTGCATGAAAAATGGCAGGGAGG - Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1185623380 X:1466719-1466741 AAGGAGGAACTAAGGGAGGGAGG - Intronic
1186005464 X:5066001-5066023 CAGGAGGAAGACAGGGAGGGAGG + Intergenic
1186253205 X:7691483-7691505 AAGGATGAACGAAGGAAGGGAGG - Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1186506677 X:10099159-10099181 GAGGATGAAGACTGGAAGGGAGG - Intronic
1187260365 X:17679847-17679869 CAGAATGAAGAAAGGGGGGGGGG + Intronic
1187731943 X:22264286-22264308 CAGTCTGGAGAATGGGAGGGAGG - Intergenic
1188309156 X:28596363-28596385 AAGGAAGAAGAAGGGGAGGGAGG - Intronic
1189169151 X:38892190-38892212 AAGGATGAACAAAGGAAGTGGGG - Intergenic
1189409336 X:40755923-40755945 CAGGATCTACTATGGGATGGAGG + Intergenic
1189518578 X:41741716-41741738 CAGGATCATGACTGGGAGGGTGG - Intronic
1190481932 X:50885744-50885766 CAGCATGAGAAATGGCAGGGAGG + Intergenic
1190938760 X:55020201-55020223 AAGGAAGAACAATGGGAGTGAGG + Intronic
1191678816 X:63819845-63819867 CAGCATGAACGGTGGGAGGAGGG - Intergenic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193534905 X:82702139-82702161 TTGCATGAACAAAGGGAGGGTGG - Intergenic
1193702415 X:84779569-84779591 CAGGGTGTACAATGGGAGTGTGG + Intergenic
1197800590 X:130343674-130343696 CAGACTGGGCAATGGGAGGGAGG + Intronic
1197996218 X:132377594-132377616 AAGGAGGAACAATGGGAAGCAGG + Intronic
1198946160 X:142016982-142017004 GATCATGAACAACGGGAGGGAGG - Intergenic
1199051363 X:143240340-143240362 CAGAATGAACAACTGGATGGGGG - Intergenic
1202279784 Y:23170306-23170328 CATCATGAACAATGGGATGTGGG - Intronic
1202280513 Y:23181146-23181168 CATCATGAACAATGGGATGTGGG - Intronic
1202281242 Y:23191994-23192016 CATCATGAACAATGGGATGTGGG - Intronic
1202284649 Y:23226526-23226548 CATCATGAACAATGGGATGTGGG + Intronic
1202432914 Y:24806377-24806399 CATCATGAACAATGGGATGTGGG - Intronic
1202436323 Y:24840913-24840935 CATCATGAACAATGGGATGTGGG + Intronic
1202437051 Y:24851761-24851783 CATCATGAACAATGGGATGTGGG + Intronic