ID: 1070112529

View in Genome Browser
Species Human (GRCh38)
Location 10:73498881-73498903
Sequence ATGAACAATGGGAGGGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 894
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 819}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070112517_1070112529 28 Left 1070112517 10:73498830-73498852 CCAAGCTGACCTCAGGGGTACAT 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG 0: 1
1: 0
2: 4
3: 70
4: 819
1070112518_1070112529 19 Left 1070112518 10:73498839-73498861 CCTCAGGGGTACATGAAGACTGC 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG 0: 1
1: 0
2: 4
3: 70
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070112529 Original CRISPR ATGAACAATGGGAGGGTGGG AGG Exonic
900241297 1:1618742-1618764 ATGAACAATGGGAATGGGGCAGG + Intronic
900735299 1:4296011-4296033 ATGACTGATGGGTGGGTGGGTGG - Intergenic
901011219 1:6203537-6203559 TTGTACAAGGGGAGGGAGGGTGG - Intronic
901199001 1:7456187-7456209 AGGAAAAATGGGAGGGAGGGAGG + Intronic
901199006 1:7456207-7456229 AGGAAGAATGGGAGAGAGGGAGG + Intronic
901199030 1:7456275-7456297 AAGAAGAATGGGAGGGAGGAAGG + Intronic
901513460 1:9730044-9730066 ATAAATAATGGCAGGATGGGGGG - Exonic
901700105 1:11040756-11040778 TAGAAGAATGGGTGGGTGGGTGG + Intronic
901700305 1:11041735-11041757 GTGAAGAATGGGTGGGTGGGTGG + Intronic
901901742 1:12370057-12370079 ATTCTCAATGGGATGGTGGGAGG - Intronic
902030057 1:13415794-13415816 AAGAACAAAGGGAGGGAGGGAGG + Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
902830466 1:19009191-19009213 AAGGCCAGTGGGAGGGTGGGGGG - Intergenic
903108018 1:21101628-21101650 AGGAAGGAAGGGAGGGTGGGAGG + Intronic
903156402 1:21446547-21446569 AGGAAGAAAGGGAGGGAGGGTGG - Intronic
903179277 1:21597293-21597315 ATGAAACATGGCATGGTGGGTGG + Intronic
903277432 1:22231056-22231078 ATAAACTATGGATGGGTGGGTGG - Intergenic
903539725 1:24090130-24090152 AGGGAGCATGGGAGGGTGGGGGG + Intronic
903565979 1:24266182-24266204 ATGGATAGAGGGAGGGTGGGAGG + Intergenic
903925549 1:26828199-26828221 ATGAAGCAAGGGTGGGTGGGTGG - Intronic
904092820 1:27957028-27957050 AGGCACAAGGGGAGAGTGGGAGG + Intronic
904754717 1:32761803-32761825 AAGAAGAGTGGGTGGGTGGGTGG + Intronic
905180530 1:36162830-36162852 ATGTCCGATGGGTGGGTGGGTGG - Intronic
905257083 1:36691741-36691763 ATGAAGACTGGGAGGCTTGGAGG + Intergenic
905312842 1:37062448-37062470 ATGAACCAGGCCAGGGTGGGTGG - Intergenic
905399865 1:37693207-37693229 ATGAAAAATGGGGGGGTGGTTGG + Intronic
905794034 1:40805427-40805449 ATGAGCAAGGGGAGAGTGGTGGG - Intronic
906107371 1:43302839-43302861 CTGAACAAAGGCAGGCTGGGGGG + Intronic
906235676 1:44207230-44207252 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
906628784 1:47347147-47347169 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
906723488 1:48026257-48026279 ATAAGCAATGGGATGGTGGTAGG + Intergenic
908993153 1:70118783-70118805 ATGAACAATGGGGGGTGGGAAGG + Intronic
909869315 1:80719134-80719156 AGGAAGAATGGAAGGGAGGGAGG - Intergenic
909899349 1:81113016-81113038 ATGAACAAAGGAAGAGTGGTAGG + Intergenic
910474886 1:87595818-87595840 AAGAAGAAAGGGAGGGAGGGAGG - Intergenic
910496388 1:87833462-87833484 ATGAAAAATACGGGGGTGGGGGG + Intergenic
910516066 1:88061420-88061442 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
910521310 1:88124888-88124910 AGGAAGGATGGGAGGGAGGGAGG + Intergenic
911013585 1:93307804-93307826 GTGAACAAGGGGAGAGTGGTAGG - Intergenic
911190422 1:94943093-94943115 AAGAAGAAAGGGAGGGTGTGTGG + Intergenic
911210990 1:95137717-95137739 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
911683424 1:100745731-100745753 ATGAAAAGTGGGAGGGAGGTGGG - Intergenic
911708558 1:101042917-101042939 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
912144877 1:106781205-106781227 AAGAACAAAGGTAGGGAGGGAGG + Intergenic
912308498 1:108595508-108595530 ATGGAGAAAGGGAGGGAGGGAGG + Intronic
912506146 1:110157750-110157772 CTGAACAATGGAAGAGTGGGAGG - Intronic
912664308 1:111565203-111565225 ATGAACAAAGGGGGGGAGTGTGG + Intronic
912666011 1:111580328-111580350 ATGGAGCATGGGAAGGTGGGAGG + Intronic
913944269 1:125142909-125142931 AGGAACAAATGGAGGGCGGGAGG + Intergenic
914227666 1:145734814-145734836 ATAAACAATGTCAGGGTGGGTGG + Intronic
914351352 1:146842940-146842962 ATGGATGATGGGTGGGTGGGTGG + Intergenic
914505003 1:148281207-148281229 ATGAAGATTGGGAGGAAGGGAGG + Intergenic
914507561 1:148302941-148302963 ATGAAGATTGGGAGGAAGGGAGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
916976583 1:170086755-170086777 AGGAAGAAAGGGAGGGAGGGGGG - Intergenic
917587426 1:176441907-176441929 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
918301919 1:183212470-183212492 ATGAGCAATGGAAGGCAGGGAGG - Intronic
918357156 1:183715756-183715778 ATGTAGAAAGGGAGGGAGGGAGG + Intronic
918807654 1:189070245-189070267 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
920204574 1:204282294-204282316 ATGAACCAAGCTAGGGTGGGAGG - Intronic
920222825 1:204416757-204416779 AGGAAGAATGGGAGGAAGGGAGG + Intergenic
920222868 1:204416929-204416951 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
920426046 1:205876082-205876104 AAGAAGAATGTGTGGGTGGGAGG - Intergenic
920881049 1:209880831-209880853 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
920919236 1:210284507-210284529 AGGACGGATGGGAGGGTGGGAGG + Intergenic
922209416 1:223476169-223476191 AAGAACCATGGGAGGGAGAGGGG - Intergenic
922609131 1:226911425-226911447 TTGAACATAGTGAGGGTGGGTGG + Intronic
923093029 1:230753853-230753875 CTAAACAAAGGGAGGGAGGGAGG - Intronic
923963598 1:239110257-239110279 ATGAACAATGGGGAGGGGTGGGG + Intergenic
924257296 1:242195091-242195113 ATCAACAATGGAAGGGTTGGAGG + Intronic
924307035 1:242700341-242700363 AAGAACAAATGGAGGGAGGGAGG + Intergenic
924581842 1:245330404-245330426 AGGGACAACGGGTGGGTGGGGGG + Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1062915167 10:1238538-1238560 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062915541 10:1239717-1239739 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062943730 10:1444430-1444452 ATGATCAATGGATGGATGGGTGG - Intronic
1063111423 10:3041041-3041063 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1063236091 10:4117875-4117897 AGGAAGGATGGGAGGGAGGGAGG + Intergenic
1063350527 10:5350232-5350254 TTGAACAATGTGGGGGTGAGGGG + Intergenic
1063949400 10:11208173-11208195 CTGTAAAATGGGAGGGTGTGGGG + Intronic
1063957989 10:11283613-11283635 ATGATGGATGGGTGGGTGGGTGG + Intronic
1064600326 10:16986256-16986278 AGGCACAGAGGGAGGGTGGGAGG - Intronic
1064688851 10:17893144-17893166 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1064724284 10:18261660-18261682 TTGAATGATGGGATGGTGGGGGG + Intronic
1064970906 10:21065868-21065890 ATTAACAAAGGGAGGGTGATGGG + Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065638333 10:27753390-27753412 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1065951636 10:30657771-30657793 ATGGAGAAAGGGAGGGAGGGAGG - Intergenic
1065966972 10:30778666-30778688 ATGAGGAGTGGGAGGATGGGGGG + Intergenic
1066478324 10:35770234-35770256 TTGAACAATGTGAGGGTTAGAGG + Intergenic
1067216912 10:44310944-44310966 ATGGAGAAGGGGAGGGTGCGCGG + Intergenic
1067309224 10:45096486-45096508 ATGGACAAAAGGAGAGTGGGAGG - Intergenic
1067829840 10:49605241-49605263 ATGAAGATGGGAAGGGTGGGAGG + Intergenic
1068249167 10:54413863-54413885 TAGAAGAATGGGAGGGTGGGAGG + Intronic
1068560131 10:58504906-58504928 AAGAGCTATGGGGGGGTGGGGGG + Intergenic
1068635832 10:59347312-59347334 ATGAACCATGGGTGGGGTGGAGG - Intronic
1068720832 10:60244273-60244295 ATGAGACATGGGAGGGTTGGGGG - Intronic
1068850343 10:61731718-61731740 ATTAAAAATGGAAGGGAGGGAGG + Intronic
1069230912 10:66007713-66007735 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1069618660 10:69822627-69822649 ATGAACAAATGAATGGTGGGTGG - Intronic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1070547896 10:77466913-77466935 AAGAAAAAAGGGAGGGAGGGGGG + Intronic
1071441007 10:85694804-85694826 TGGAAAAGTGGGAGGGTGGGAGG + Intronic
1072026354 10:91463058-91463080 TTGAACAATGCGAGGGTTAGGGG + Intronic
1072309606 10:94141651-94141673 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1072957135 10:99897249-99897271 ATGAAGAAGGAGTGGGTGGGTGG + Intronic
1073119682 10:101113918-101113940 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1073973065 10:109066852-109066874 GTTACCAATGGGTGGGTGGGAGG - Intergenic
1074399312 10:113128749-113128771 ATGAAGGAGGGGAGTGTGGGAGG - Intronic
1074731832 10:116386520-116386542 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1075065301 10:119285326-119285348 GAGTACAGTGGGAGGGTGGGTGG + Intronic
1075556135 10:123434000-123434022 ATCACCCAGGGGAGGGTGGGAGG + Intergenic
1075967858 10:126628346-126628368 AGGAAAAATGGGTGGGTGGATGG + Intronic
1076054949 10:127364811-127364833 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1077479907 11:2808886-2808908 ATGGACAATGGGTGGGTAGATGG + Intronic
1078076777 11:8169226-8169248 ATGAACATGGGGAGTGAGGGAGG - Intergenic
1078405413 11:11066554-11066576 ATGAACCATGGGATGGAAGGAGG + Intergenic
1078569343 11:12444100-12444122 ATGAGCAAAGGGATGCTGGGGGG - Intronic
1078617258 11:12877763-12877785 AGGAAGAAAGGGAGGGTGGGAGG - Intronic
1079356698 11:19735856-19735878 AAGAACAAATGGAGGTTGGGAGG + Intronic
1080022080 11:27572778-27572800 ATGAAGAAAGGAAGGGAGGGTGG - Intergenic
1081639348 11:44742296-44742318 AGGAAAAAAGGGAGGGAGGGAGG - Intronic
1081974616 11:47224738-47224760 AGGAACGAAGGGAGGGAGGGAGG - Intronic
1082170988 11:49004595-49004617 ACGGACGGTGGGAGGGTGGGAGG + Intergenic
1082189961 11:49231181-49231203 ATGAAGAAAGGAATGGTGGGAGG + Intergenic
1082274794 11:50209605-50209627 ATGAAAGGTGGGAGGCTGGGAGG + Intergenic
1082778901 11:57270987-57271009 AGGAACATGGGGAGGGAGGGAGG - Intergenic
1082873846 11:57968716-57968738 AGGAACGAAGGGAGGGAGGGAGG - Intergenic
1083023286 11:59528861-59528883 ATGAAGAATGGGCGAGTGTGAGG + Intergenic
1083115538 11:60455845-60455867 AAGCACACTGGGAGGGTGAGTGG - Exonic
1083225536 11:61282225-61282247 AAGAAAAACGGGAGGGTGGAAGG - Intronic
1083640577 11:64143117-64143139 AGGAAAGAAGGGAGGGTGGGAGG + Intronic
1084596245 11:70118653-70118675 ATGATTGATGGGTGGGTGGGTGG + Intronic
1084596379 11:70119249-70119271 ATGGATGATGGGGGGGTGGGTGG + Intronic
1085038995 11:73315932-73315954 ATCACAGATGGGAGGGTGGGAGG - Intronic
1085276541 11:75303698-75303720 AAGCACAGTGGGAGGGTGGGAGG + Intronic
1085660993 11:78366630-78366652 ATGCACAAAGTGAGGATGGGGGG + Intronic
1085728480 11:78975799-78975821 AGCAACTGTGGGAGGGTGGGAGG + Intronic
1086073587 11:82825635-82825657 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1086676567 11:89615361-89615383 ATGAAGAAAGGAATGGTGGGAGG - Intergenic
1087580403 11:100044042-100044064 GGGAAGAGTGGGAGGGTGGGAGG - Intronic
1089037546 11:115410480-115410502 AGGCAGAATGGGAGGGTGGGGGG + Intronic
1089166404 11:116480626-116480648 ATGAACAGTGGGAAGATGGATGG + Intergenic
1089283946 11:117393841-117393863 GTGAACAATGGGTGGGTAGAGGG + Intronic
1089356181 11:117855522-117855544 GTGGTCACTGGGAGGGTGGGAGG - Intronic
1089413732 11:118269062-118269084 AGGAAGAATGGGTGGGTGGGTGG + Intergenic
1089658025 11:119965948-119965970 TTGAACAAAGGAAGGGTGGGTGG + Intergenic
1090036488 11:123253920-123253942 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1090746045 11:129705596-129705618 AAGAACAATATGAGAGTGGGAGG - Intergenic
1090902191 11:131042926-131042948 AGGAACAGGGGGAGGCTGGGTGG + Intergenic
1091142806 11:133250485-133250507 ATGAAGAAAGGGAGGAAGGGAGG + Intronic
1093675036 12:21928293-21928315 AGGAAGGAAGGGAGGGTGGGAGG + Intronic
1093859961 12:24153127-24153149 AAGCACAATGGGAGGTTTGGTGG - Intergenic
1094053825 12:26248282-26248304 AGGAAGAGAGGGAGGGTGGGAGG - Intronic
1094391736 12:29959034-29959056 AGCAACAATGGGAGGATGTGGGG - Intergenic
1094427095 12:30327378-30327400 ATGATCTTTGGCAGGGTGGGAGG - Intergenic
1095155605 12:38850171-38850193 AGGAACAGTGGGAGGGTGGAGGG - Intronic
1095554750 12:43487420-43487442 GGGAAGAGTGGGAGGGTGGGAGG + Intronic
1095872914 12:47050498-47050520 AGATACAATGGGTGGGTGGGTGG + Intergenic
1096214680 12:49792595-49792617 AGGAACAAAGGGAAGGTGGATGG + Intronic
1096576449 12:52555938-52555960 AGGAAGAAAGGAAGGGTGGGAGG - Intergenic
1096744276 12:53715342-53715364 AAGGAAAATGGGAGGGTGGAGGG + Intronic
1096806429 12:54143861-54143883 ATGAAGAGTGGGAGGGAGAGAGG - Intergenic
1097829140 12:64205644-64205666 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1097969377 12:65616137-65616159 AAGAAAAAAGGGAGGGAGGGAGG - Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1098909830 12:76197596-76197618 AAGAACAATGGGAGTGGGGAGGG + Intergenic
1099930617 12:89070159-89070181 AAGAAAAATGGTAGGGTGAGAGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100922783 12:99507900-99507922 ATGAACATGGGGTGGGTTGGGGG - Intronic
1101139408 12:101779703-101779725 GTGAACAATGGAAGCATGGGAGG - Intronic
1101439960 12:104696172-104696194 AAGAAAAAAGGTAGGGTGGGTGG - Intronic
1102520909 12:113477020-113477042 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1102520937 12:113477105-113477127 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1102556056 12:113727327-113727349 AGGAAGGATGGGAGGGAGGGAGG - Intergenic
1102556339 12:113729299-113729321 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1102821825 12:115915059-115915081 TTGAAGAGTGGGAGGGTAGGGGG + Intergenic
1102856116 12:116295538-116295560 ATGAAGGATGGGTGGGTGGATGG + Intergenic
1103245122 12:119450254-119450276 AGGAAGGGTGGGAGGGTGGGAGG + Intronic
1103978628 12:124720994-124721016 AGGAACAAGGGGAGGGTGCTGGG + Intergenic
1104778492 12:131404975-131404997 ATGAATGATGGATGGGTGGGTGG - Intergenic
1104778600 12:131405369-131405391 ATGATGGATGGGTGGGTGGGTGG - Intergenic
1104896199 12:132166228-132166250 ATGGATAATGGATGGGTGGGTGG - Intergenic
1104896236 12:132166386-132166408 ATGAAGGATGGGTGGGTGGATGG - Intergenic
1104896262 12:132166496-132166518 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1104896298 12:132166632-132166654 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1104896307 12:132166659-132166681 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1105396149 13:20037942-20037964 ATGAAAGAGTGGAGGGTGGGAGG - Intronic
1105559722 13:21479025-21479047 AGGAACAGAGGGAGGGAGGGAGG + Intergenic
1105844850 13:24285518-24285540 AAGAAAAAAGGGAGGGAGGGAGG - Intronic
1106133533 13:26958337-26958359 TTGCTCCATGGGAGGGTGGGGGG + Intergenic
1106187346 13:27421057-27421079 ATGAAACCTGGGAGGGTAGGTGG + Intergenic
1106248885 13:27969197-27969219 AGGAAGAAAGGGAGGGAGGGAGG - Exonic
1106919892 13:34552070-34552092 ATCAAGAATGGTGGGGTGGGGGG + Intergenic
1106929327 13:34646904-34646926 GTGAATAGTGGGAGGGAGGGAGG + Intergenic
1107179732 13:37444951-37444973 ATGGATATTTGGAGGGTGGGAGG - Intergenic
1107510591 13:41080057-41080079 ATAAAAGGTGGGAGGGTGGGAGG + Intronic
1108004916 13:45936501-45936523 AAGAAAAATGGGGTGGTGGGAGG + Intergenic
1109493926 13:63143146-63143168 AGGAAGGAAGGGAGGGTGGGAGG + Intergenic
1109693493 13:65923659-65923681 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1109759662 13:66811574-66811596 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1109844765 13:67973727-67973749 ACAAAAAATGGGAGGGTAGGAGG - Intergenic
1110259680 13:73471449-73471471 ATGAACAAAGGCAGAGTGGTGGG + Intergenic
1110390617 13:74969134-74969156 ATGAAGAATGGCAGGGTAGTAGG + Intergenic
1110997103 13:82124174-82124196 AAGAATAATGGGAGGGTGGGGGG - Intergenic
1111016340 13:82387058-82387080 ATGAACAAAGTGGGGGTGGCAGG - Intergenic
1111381840 13:87464834-87464856 TTGGCCAATGGGTGGGTGGGTGG + Intergenic
1111452592 13:88438661-88438683 AGGAAAAAAGGGAGGGAGGGAGG + Intergenic
1112258099 13:97852914-97852936 TGGAAAAATGGGTGGGTGGGTGG + Intergenic
1112335885 13:98515506-98515528 ATAAATATTGGGGGGGTGGGGGG + Intronic
1112752899 13:102599646-102599668 ATGATCAAGTGGAGGATGGGTGG + Intronic
1112764358 13:102724922-102724944 AAGAACAATGGGATGATGAGAGG - Intergenic
1113359177 13:109612596-109612618 ATGAACTTTGGGAGGATGGGAGG + Intergenic
1113402481 13:110006662-110006684 TTGAGCAATGGGAGGGAAGGAGG - Intergenic
1113809436 13:113129436-113129458 ATGAACACTGGAAGGCAGGGAGG - Exonic
1114775065 14:25472700-25472722 TTGAACAATGTGAGGGTTGCAGG - Intergenic
1115864682 14:37732004-37732026 TTGAACAATGTGAGGGTTGGGGG + Intronic
1116624627 14:47248946-47248968 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1116859053 14:49979148-49979170 ATGCACAAGGGCAGGGAGGGAGG - Intergenic
1117472039 14:56056147-56056169 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1117723848 14:58652885-58652907 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1118749322 14:68794997-68795019 CTGAAAAATGGGAGCGGGGGAGG - Intronic
1119071103 14:71585136-71585158 ATGAGAAAAGGGAGGGAGGGAGG + Intronic
1119394606 14:74316996-74317018 ATGAACAAGGGGAGAGTGATAGG + Intronic
1119536508 14:75407212-75407234 TGGCAAAATGGGAGGGTGGGAGG - Intergenic
1119610850 14:76060813-76060835 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1119639250 14:76302436-76302458 ATCAATGATGGGAGAGTGGGAGG + Intergenic
1120367732 14:83591983-83592005 AGGAAGGATGGGAGGGAGGGAGG - Intergenic
1120673382 14:87389961-87389983 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1120689851 14:87580413-87580435 ATGGACATCGGGAGGATGGGAGG + Intergenic
1121050826 14:90817779-90817801 ATGAACTCTGAGAGGTTGGGGGG + Intergenic
1121436028 14:93920473-93920495 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1121902327 14:97705078-97705100 ATGAAAAAAGTGGGGGTGGGAGG - Intergenic
1122012158 14:98759178-98759200 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1122222778 14:100251738-100251760 AGGGACAAAGGGAGGGAGGGAGG - Intronic
1122910292 14:104824519-104824541 ATGGACAGTAGGATGGTGGGTGG + Intergenic
1124957715 15:34370661-34370683 ATAAAACATGGGAGGTTGGGAGG - Intergenic
1125132581 15:36300895-36300917 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1126259824 15:46676260-46676282 ATGAACAAAGGGAAAGTGAGAGG - Intergenic
1126279591 15:46929260-46929282 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1126321486 15:47428985-47429007 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1126417059 15:48428567-48428589 AGGAACAAAGGGAGGGAAGGAGG - Intronic
1127070978 15:55288601-55288623 AAGAAAAAAGGGAGGGAGGGAGG + Intronic
1127329389 15:57923718-57923740 ATGAACGATGTGAAGGTGGTGGG - Intergenic
1127453739 15:59139852-59139874 ATTAATAATGAGGGGGTGGGAGG - Intronic
1127501009 15:59554066-59554088 ATGAACAATGGGAGGGCATATGG - Intergenic
1127537544 15:59904174-59904196 AGGGACAATGGAAGAGTGGGAGG + Intergenic
1127545430 15:59990220-59990242 AGGAAGTATGGGAGGGAGGGAGG + Intergenic
1127560533 15:60132322-60132344 AGGAAGAATGGAAGGGAGGGAGG + Intergenic
1128706377 15:69840026-69840048 TTGAACTTGGGGAGGGTGGGGGG + Intergenic
1129702881 15:77777950-77777972 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1129798379 15:78395258-78395280 ATTAACAAGGGGAAGATGGGAGG + Intergenic
1130059742 15:80560863-80560885 AAGAGCTCTGGGAGGGTGGGAGG - Intronic
1130516012 15:84626163-84626185 ATAAAAAATGGAAGGGAGGGAGG - Intronic
1130720314 15:86380244-86380266 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1130839211 15:87682034-87682056 GTGAAAAATGGCAGGGAGGGAGG + Intergenic
1131689754 15:94813954-94813976 ATCAAGAAAGGGAGGGAGGGAGG + Intergenic
1131765160 15:95668137-95668159 AAGAACATTGGGAGAGGGGGAGG - Intergenic
1132000359 15:98173145-98173167 CTGAAGACTGGGGGGGTGGGGGG + Intergenic
1132347384 15:101116450-101116472 CTGAATATTGGAAGGGTGGGTGG - Intergenic
1132607551 16:799913-799935 CTGAACCTTGGGAGGGTGGGTGG + Intronic
1133003349 16:2862797-2862819 TTGGAGACTGGGAGGGTGGGAGG + Intergenic
1133399439 16:5473905-5473927 ATGAAGGAAGGAAGGGTGGGTGG + Intergenic
1133579548 16:7129831-7129853 ATGATGGATGGGTGGGTGGGTGG + Intronic
1133758668 16:8781133-8781155 ATGAAGACTGGATGGGTGGGTGG + Intronic
1134105952 16:11486161-11486183 ATAGATGATGGGAGGGTGGGCGG + Intronic
1134106020 16:11486524-11486546 ATAGATGATGGGAGGGTGGGTGG + Intronic
1134106045 16:11486613-11486635 ATGGATGATGGGTGGGTGGGTGG + Intronic
1134106080 16:11486737-11486759 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134106089 16:11486768-11486790 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134106132 16:11486900-11486922 ATGAATCATGGGTGGGTGGTAGG + Intronic
1134106146 16:11486950-11486972 ATGGATAATGGGTGGGTGGGTGG + Intronic
1134197898 16:12173044-12173066 AAGAACAAAGAGAGGGTTGGAGG + Intronic
1134224697 16:12381286-12381308 ATGGATAATGGGTGGGTGGATGG - Intronic
1134224734 16:12381421-12381443 ATGATGGATGGGTGGGTGGGTGG - Intronic
1134224736 16:12381425-12381447 ATGAATGATGGATGGGTGGGTGG - Intronic
1134224756 16:12381499-12381521 ATGAATGATGGGTGGGTGGGTGG - Intronic
1134224792 16:12381618-12381640 ATGAATGATGGGTGGGTGGGTGG - Intronic
1134224819 16:12381695-12381717 ATGGACGATGGGTGGGTGGGTGG - Intronic
1134748022 16:16602864-16602886 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1134820279 16:17241257-17241279 ATAAACAAGGGGAGAGAGGGAGG + Intronic
1134839905 16:17393448-17393470 GTGAAGAGTGGGAGGGTGGTTGG - Intronic
1134997446 16:18750795-18750817 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1135186121 16:20317105-20317127 ATAAACGCAGGGAGGGTGGGAGG - Intronic
1135414456 16:22258138-22258160 AGTAGCAATGGGAGGATGGGAGG - Intronic
1135543235 16:23348446-23348468 AGGAAAAAAGGGAGGGAGGGAGG + Intronic
1135547646 16:23376870-23376892 ATGAACAAAGGGTGGGTGACTGG - Intronic
1135607205 16:23835580-23835602 ATGACCAATGGGATGGATGGGGG + Intergenic
1135913138 16:26579190-26579212 AGGAAGAAGGGGAGGGAGGGAGG - Intergenic
1136779362 16:32886850-32886872 AGGAACACGGGGTGGGTGGGGGG - Intergenic
1136891255 16:33974668-33974690 AGGAACACGGGGTGGGTGGGGGG + Intergenic
1136968354 16:34942115-34942137 AGGAAGAAAAGGAGGGTGGGAGG + Intergenic
1137088823 16:36162669-36162691 AGGAAGAAAGGGAGGGCGGGAGG + Intergenic
1137219794 16:46437374-46437396 AGGAAGAAAAGGAGGGTGGGAGG - Intergenic
1137758731 16:50923362-50923384 ATGAACACTGGGTTGGTGGTGGG + Intergenic
1137765020 16:50971416-50971438 ATGAGAAATGGGTGGGTGAGTGG - Intergenic
1138183965 16:54962447-54962469 TTGAAGAAAGGGAGGGAGGGAGG - Intergenic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1138752519 16:59440801-59440823 AGGAAAAAAGGGAGGGAGGGAGG - Intergenic
1139018224 16:62715878-62715900 ATGAACAAAGGAAGGGTATGTGG + Intergenic
1139730280 16:68938244-68938266 AAGAACAATGAGAAGGTTGGAGG + Intronic
1139982686 16:70872610-70872632 ATGGATGATGGGTGGGTGGGTGG - Intronic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1140340801 16:74158780-74158802 ATTAACAGTGGTAGGTTGGGTGG - Intergenic
1140879027 16:79180685-79180707 ATGAAGAAATGGAGGGAGGGAGG - Intronic
1140900542 16:79363186-79363208 ATGAACAAGGGTAGGGGGGTGGG + Intergenic
1141045980 16:80716478-80716500 ATGAACAATGGGTGGGTGGATGG + Intronic
1141234587 16:82203700-82203722 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1141641809 16:85346057-85346079 ATGAACAATGGATAGGTGGATGG + Intergenic
1141641825 16:85346123-85346145 ATGAACAATGGATGGGTAGATGG + Intergenic
1141834352 16:86528786-86528808 ATGAGCAATGGGAGGCTCAGAGG + Intergenic
1141854932 16:86674278-86674300 ATGAACAAATGAATGGTGGGAGG - Intergenic
1141909667 16:87050142-87050164 ATGAACGCTGGGTGGGTGGGAGG - Intergenic
1142152661 16:88519569-88519591 TGGATGAATGGGAGGGTGGGTGG + Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1203081778 16_KI270728v1_random:1148938-1148960 AGGAACACGGGGTGGGTGGGGGG - Intergenic
1143306295 17:5949714-5949736 ATGAAGGATGGAAGTGTGGGTGG - Intronic
1143419635 17:6778659-6778681 TTGAACAATGGGGGTTTGGGAGG + Intronic
1144477173 17:15598382-15598404 AGGAAGGATGGGTGGGTGGGTGG + Intronic
1144606889 17:16674546-16674568 AGGAACGAAGGGAGGGAGGGAGG + Intergenic
1144625054 17:16840237-16840259 AAGCACAAAGGGAGGGTGGGTGG - Intergenic
1144881376 17:18432484-18432506 AAGCACAAAGGGAGGGTGGGTGG + Intergenic
1144921067 17:18764987-18765009 AGGAAGGATGGGTGGGTGGGTGG - Intronic
1145150856 17:20511902-20511924 AAGCACAAAGGGAGGGTGGGTGG - Intergenic
1145283216 17:21483598-21483620 TTGAACAATGTGAGAGTTGGGGG - Intergenic
1145394267 17:22482202-22482224 TTGAACAATGTGAGAGTTGGGGG + Intergenic
1145426331 17:22903194-22903216 GTGGACATTGGGAGGGTGTGAGG + Intergenic
1146445131 17:32927452-32927474 ATGAAGGATGGCAGGGTAGGGGG + Intergenic
1146631297 17:34471690-34471712 AGGAAGAAAGGGAGGGTGGGTGG - Intergenic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1146879398 17:36434469-36434491 AGGACCCATGGGAGGGTGGCAGG - Intronic
1147094818 17:38132986-38133008 AGGACCCATGGGAGGGTGGCAGG + Intergenic
1147579208 17:41618934-41618956 AAGCACAAAGGGAGGGTGGGTGG - Intergenic
1147589116 17:41669929-41669951 ATGAACAATGGGAAGGTTGTGGG + Intergenic
1148067791 17:44885556-44885578 AGGGACAGTGGGAGGGAGGGAGG + Intronic
1148743983 17:49908287-49908309 ATCAACACTGGGTGGGAGGGAGG + Intergenic
1148792918 17:50183684-50183706 ATGGATACTGGGAGGGTGAGGGG - Exonic
1149007527 17:51821130-51821152 ATAAATATTGGGAGGGAGGGAGG - Intronic
1149572539 17:57683635-57683657 AGGAACAGAGGGAGAGTGGGGGG + Exonic
1149600795 17:57891827-57891849 AGGAACACTGGGATGTTGGGGGG - Intronic
1149728822 17:58924277-58924299 AGGAACAAAGGGAAGGAGGGAGG + Intronic
1150802743 17:68294606-68294628 AGGAAGAATGGAAGGGTGGGTGG - Intronic
1150918508 17:69459985-69460007 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1151005152 17:70427029-70427051 ATGTCCAATAGGAGGGTAGGAGG - Intergenic
1151147923 17:72058396-72058418 TTGAACTCTGGGAGGGTGGGGGG - Intergenic
1151232210 17:72693216-72693238 GAGGACAGTGGGAGGGTGGGTGG - Intronic
1151256342 17:72879735-72879757 AGAAACAATGGGAGGGCAGGTGG - Intronic
1152168221 17:78724656-78724678 ATAAACAATGGAAGAGGGGGTGG + Intronic
1152232411 17:79120631-79120653 ATGAAAAATTGGTGGGTGTGTGG + Intronic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153100432 18:1462203-1462225 ATGAACCCAGGGTGGGTGGGTGG - Intergenic
1154024264 18:10692445-10692467 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1154167052 18:12023572-12023594 ATGAGCACAGGGCGGGTGGGTGG - Intronic
1155488571 18:26373784-26373806 GTGAACAGAGGGAGGGAGGGAGG - Intronic
1155554358 18:27001689-27001711 ATGCATGGTGGGAGGGTGGGAGG + Intronic
1156123155 18:33869932-33869954 ATGAAGAAAGGCAGGGTGGATGG + Intronic
1156314684 18:35957579-35957601 AAGAACAAAGGAAGGGAGGGAGG + Intergenic
1156314705 18:35957739-35957761 AAGAACAAAGGAAGGGAGGGAGG + Intergenic
1156922318 18:42536827-42536849 CTAAAAGATGGGAGGGTGGGTGG + Intergenic
1156966909 18:43105491-43105513 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1157371209 18:47113927-47113949 GTGGACAATGAGACGGTGGGGGG + Intronic
1157396402 18:47345430-47345452 ATGAAAAATGGGTGAGAGGGTGG + Intergenic
1157634766 18:49141110-49141132 ATGAACAATGGGAAGGAAAGAGG - Intronic
1157877978 18:51291510-51291532 AAGGAAAATGGGAGGGAGGGAGG - Intergenic
1158692389 18:59672215-59672237 ATGATCCATGGGGTGGTGGGTGG + Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1158947097 18:62456649-62456671 AAGAAGAGTGGGAGGGTGGGTGG - Intergenic
1159108201 18:64027285-64027307 ATGAAAAGGGGGAGGGAGGGGGG - Intergenic
1159514042 18:69434921-69434943 AAGAAAAAAGGGAGGGAGGGAGG + Intronic
1160041261 18:75347750-75347772 ATGAAGAGAGGGAGGGAGGGAGG + Intergenic
1160085125 18:75770038-75770060 ATTAACATAGGGTGGGTGGGGGG + Intergenic
1160383108 18:78475744-78475766 GTCAACACTGGGAGGGTAGGAGG + Intergenic
1160526663 18:79542592-79542614 ATGGATAATGGGTGGGTGGGTGG - Intergenic
1160544999 18:79647287-79647309 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1160713791 19:565774-565796 AGGAAGGAAGGGAGGGTGGGAGG - Intergenic
1160825422 19:1078037-1078059 AAGAACAAGGTGAGGGCGGGTGG + Exonic
1160926818 19:1550416-1550438 ATGTTGAATGGGTGGGTGGGTGG - Intergenic
1161337622 19:3722820-3722842 AGGAACAATGGCAGAGAGGGCGG - Intronic
1161734117 19:5979913-5979935 GGGAACAAGGGGAGGGAGGGAGG - Intergenic
1161750862 19:6095603-6095625 GTAAACAAGGGGAGGGTGTGTGG + Intronic
1161881229 19:6954428-6954450 AGGAAGAAAGGAAGGGTGGGTGG + Intergenic
1162171190 19:8790273-8790295 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1162269635 19:9603667-9603689 AGGAACGAAGGGAGGGAGGGAGG + Intergenic
1162752816 19:12838945-12838967 AGGAAGAAGGGGAGGCTGGGGGG + Intronic
1163026485 19:14515845-14515867 GTGGACCATGAGAGGGTGGGAGG - Exonic
1163109062 19:15147224-15147246 AGGAAAGATGGGAGGGAGGGAGG + Intergenic
1163207248 19:15812642-15812664 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1164463119 19:28465225-28465247 AGGAACAGTGGGAGGGTTGAGGG + Intergenic
1164639889 19:29816847-29816869 ATCAAAAATGGGGGGGAGGGGGG - Intronic
1164714881 19:30384243-30384265 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1164744096 19:30598932-30598954 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1164932068 19:32183547-32183569 ATGAGCAATTTGAGGATGGGAGG + Intergenic
1165141154 19:33700711-33700733 ATGCACAATTGGAGGTGGGGAGG + Intronic
1165168148 19:33871758-33871780 AGGAAGAATGGGTGGATGGGTGG - Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166193910 19:41193945-41193967 ATGCAGGATGGGAGGATGGGTGG + Intronic
1166350335 19:42195024-42195046 AGGAACGAAGGGAGGGAGGGAGG + Intronic
1166350374 19:42195132-42195154 AGGAACGAAGGGAGGGAGGGAGG + Intronic
1166658414 19:44628898-44628920 TTGAACAAAGGGAGGGAGTGGGG + Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1167098960 19:47392249-47392271 ATGACCAAAGGCAAGGTGGGTGG - Intergenic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
1167325779 19:48824439-48824461 AAGAAAAAAGGGAGGGAGGGAGG + Intronic
1167387645 19:49173461-49173483 AGGAAGAATGGGTGGGTGGATGG - Intronic
1167584484 19:50365889-50365911 CTGAAGGATGGGGGGGTGGGAGG - Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168480648 19:56717036-56717058 AGGAACAATGGGATGGTGTAGGG - Intergenic
1168505671 19:56932801-56932823 CGGAACAAAGGGAGGGAGGGAGG - Intergenic
1168561034 19:57383513-57383535 CAGAAGAATGGGATGGTGGGGGG - Intronic
925025730 2:605902-605924 GTGAGCAAGTGGAGGGTGGGCGG - Intergenic
925119369 2:1405412-1405434 ATGAAGAATGGATGGATGGGTGG - Intronic
925259063 2:2513904-2513926 ATAAACACTGGAATGGTGGGTGG + Intergenic
925284219 2:2705433-2705455 TTGAAGAGTGGGAGGGTGGTAGG - Intergenic
925434712 2:3826964-3826986 ATAAACAATTGGAGGGAGGAAGG - Intronic
925775859 2:7335127-7335149 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
926055600 2:9772185-9772207 AAGCACAAAGGGAAGGTGGGAGG + Intergenic
926118704 2:10229309-10229331 GTGAACAGGGGGAGGGTGGGGGG + Intergenic
926263289 2:11288648-11288670 AGAAACAATGGGAGCCTGGGAGG + Intronic
926633029 2:15154764-15154786 CTGGACAATGTGAGAGTGGGGGG + Intergenic
926663984 2:15499608-15499630 ATGAGCAGGTGGAGGGTGGGAGG + Intronic
926809873 2:16746579-16746601 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
927254626 2:21029474-21029496 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
927438721 2:23093525-23093547 ATGAACTAGGGCAGGGTGGGGGG + Intergenic
928032921 2:27796911-27796933 AGGGACAATGGGAGGGAGAGAGG - Intronic
928092345 2:28382756-28382778 ATGAAGAAAGGGAGGGAAGGTGG - Intergenic
928259108 2:29750726-29750748 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
929154036 2:38773429-38773451 AAGAACGAAGGGAGGGAGGGAGG - Intronic
929172816 2:38948581-38948603 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
930035628 2:47083578-47083600 TGGAACCATGGGAGGCTGGGAGG - Intronic
930097827 2:47580397-47580419 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG + Intronic
930826374 2:55700413-55700435 AGGAAGAAAGGGAAGGTGGGAGG - Intergenic
932502459 2:72195367-72195389 ATGTTCAAGGGGAGGATGGGAGG + Intronic
932810044 2:74817592-74817614 CAGAACAATGGAAGAGTGGGAGG - Intergenic
933337367 2:80975556-80975578 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
933362737 2:81308471-81308493 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
933485309 2:82914342-82914364 TTGAACAATGTGAGGGTTAGGGG + Intergenic
933563831 2:83924491-83924513 ATGAACTTTGGGAGGGTGGTGGG - Intergenic
933581071 2:84127765-84127787 AGGAACAATGTGAGTGTGAGAGG + Intergenic
933708428 2:85308348-85308370 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
933716098 2:85361941-85361963 AAGAAAAAGTGGAGGGTGGGAGG + Intronic
934103147 2:88672126-88672148 ATGAAGACTGGGAGGATGAGGGG + Intergenic
934166828 2:89301634-89301656 ATTTACAATGGGAGGGAAGGAGG - Intergenic
934200452 2:89880823-89880845 ATTTACAATGGGAGGGAAGGAGG + Intergenic
935171501 2:100614139-100614161 AGGAAGGATGGGAGGGAGGGAGG - Intergenic
935187756 2:100749373-100749395 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
935323813 2:101915945-101915967 TTGAACAATGCGAGGGTTAGGGG - Intergenic
936259088 2:110942972-110942994 AAGAAGAGTGGGAGGGAGGGAGG + Intronic
936322404 2:111478027-111478049 AGGAACGAAGGGAGGGAGGGAGG + Intergenic
936631637 2:114209437-114209459 AGGAAAAGTGGGAAGGTGGGTGG + Intergenic
936831228 2:116650152-116650174 TTGAACAATGTGAGGGTTAGGGG + Intergenic
936956999 2:118032455-118032477 AGGGATAATGGGTGGGTGGGTGG + Intergenic
937261649 2:120590426-120590448 GTGAACAAAGGAAGGGAGGGCGG - Intergenic
937575350 2:123413928-123413950 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
938420758 2:131144490-131144512 ATAAAAGATGGGAGGATGGGAGG - Intronic
938867916 2:135443333-135443355 ACGGACAATGGGAGTGTCGGGGG + Intronic
939196950 2:138985016-138985038 AGGAACGAAGGGAGGGAGGGAGG - Intergenic
939309952 2:140463169-140463191 GTGGCCAGTGGGAGGGTGGGTGG + Intronic
939319907 2:140605672-140605694 AAGAAAAAAGGGAGGGAGGGAGG - Intronic
939425698 2:142033489-142033511 AGGAAGTGTGGGAGGGTGGGGGG - Intronic
941408789 2:165126583-165126605 AGGAACGAAGGGAGGGAGGGAGG - Intronic
942424209 2:175842085-175842107 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
943227890 2:185205021-185205043 AGGAACAAAGGGAGGGAGGGAGG - Intergenic
943533470 2:189116571-189116593 AAGATCTATGGGATGGTGGGAGG + Intronic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
943786170 2:191881071-191881093 GTGGACCATGAGAGGGTGGGAGG - Intergenic
945297468 2:208184795-208184817 ATGAACAATCTCAGGGTGAGGGG + Intronic
945819684 2:214648764-214648786 CTGAAGAATGGGTGAGTGGGAGG - Intergenic
946010384 2:216559661-216559683 ATGAAGAATGGGGTGGCGGGGGG + Intronic
946485185 2:220094707-220094729 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
946610795 2:221455496-221455518 ATAAACACTGGGAAGGTCGGGGG + Intronic
946896375 2:224328394-224328416 TTGAGAAATGGGAGTGTGGGAGG - Intergenic
947746713 2:232511725-232511747 ATGATTAATGGGAGGCAGGGAGG - Intergenic
947869244 2:233423804-233423826 ATGGATACTGGGGGGGTGGGTGG - Intronic
948330647 2:237161671-237161693 ATGAACAATGGGAGCTGGGATGG + Intergenic
948407559 2:237733845-237733867 ATGCACAGTGGGAGGGGGTGCGG - Intronic
949071355 2:242026754-242026776 ATGAACCATGTCAGTGTGGGTGG - Intergenic
1169109200 20:3021034-3021056 CTGAACCAAGGGAGTGTGGGTGG + Intronic
1169257601 20:4110929-4110951 ATGACCAATGGAAGAGAGGGAGG + Intergenic
1169421944 20:5467441-5467463 ATAAGAAATGGGAGGGAGGGAGG - Intergenic
1169530994 20:6484946-6484968 AGGAATAAAGGGAGGGAGGGAGG - Intergenic
1170389719 20:15858898-15858920 TTGAACAATGTGAGGGTGAGTGG + Intronic
1170415215 20:16132447-16132469 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172625474 20:36344132-36344154 CTGAACAGTGGGAGTGTGGTGGG + Intronic
1172970769 20:38871579-38871601 AGGAACGAAGGGAGGGAGGGAGG + Intronic
1173870742 20:46340526-46340548 ATGAAGGATGGGTGGGTGGGAGG - Intergenic
1173976456 20:47190290-47190312 ATGATTAATTGGAAGGTGGGTGG + Intergenic
1174140819 20:48412500-48412522 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1174701238 20:52611246-52611268 AGGAATAAAGGGAGGGAGGGAGG - Intergenic
1174842724 20:53915438-53915460 ATAAACAACGCGGGGGTGGGGGG - Intergenic
1175059633 20:56230378-56230400 AAGAAAAAAGGGAGGGAGGGAGG + Intergenic
1175304863 20:57969025-57969047 AGGATAAAAGGGAGGGTGGGTGG + Intergenic
1175779218 20:61671745-61671767 ATGAATGATGGGTGGGTGTGTGG + Intronic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177736517 21:25097576-25097598 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1178184950 21:30208469-30208491 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1178413203 21:32382892-32382914 AGGAAAAATGGGAGTGTGGATGG - Intronic
1178716735 21:34971565-34971587 ATAAATGATGGAAGGGTGGGTGG - Intronic
1178920778 21:36736752-36736774 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1178920786 21:36736811-36736833 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1179107047 21:38410575-38410597 ATAAGCAGTGGGAGGGAGGGAGG + Intronic
1179240687 21:39588554-39588576 ATAAAAGATGGGAGGGTGGGAGG - Intronic
1179601821 21:42483893-42483915 ATTAACAAAGGGATGATGGGAGG - Intronic
1180024961 21:45155838-45155860 ATGGATGATGGGTGGGTGGGTGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1181530355 22:23513820-23513842 CTGAACAATGGCAGTGTGGCCGG + Intergenic
1181779694 22:25183828-25183850 AGGAAGGATGGGAGGGAGGGAGG - Intronic
1181877079 22:25948079-25948101 ATGATCGATGGGTGGGTGGATGG - Intronic
1181921066 22:26320827-26320849 TGGGACAATGGGAGGGTGCGGGG + Intronic
1182060726 22:27395255-27395277 ATGAATGATGGGTGGGTGAGTGG + Intergenic
1182741681 22:32572366-32572388 AGGAAAGATGGGAGGGAGGGTGG - Intronic
1182903099 22:33915262-33915284 ATTGAGAATGGGAGGGTAGGTGG - Intronic
1182973035 22:34595356-34595378 AGGGACAAAGGGAGGGAGGGAGG + Intergenic
1183082147 22:35463419-35463441 ATGAATCATGGGTGGATGGGTGG - Intergenic
1183177579 22:36235734-36235756 AGGAAGAAAGGGTGGGTGGGTGG + Intronic
1183239142 22:36643024-36643046 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1183615692 22:38944031-38944053 AGGAAGGATGGGAGGGAGGGAGG - Intergenic
1184663013 22:45974218-45974240 ATGAAGAAAGGGAGGCTGAGAGG + Intronic
1184731311 22:46372508-46372530 AGGATGAATGGGTGGGTGGGGGG - Intronic
1184744612 22:46449094-46449116 ATGAACAATGGATGGGTGGATGG - Intronic
1184855079 22:47142351-47142373 TGGAAGAATGGGTGGGTGGGTGG - Intronic
1184860087 22:47168684-47168706 CAGAACAGTGGGTGGGTGGGTGG - Intronic
1185104421 22:48859190-48859212 ATGGAGGATGGGAGGGAGGGAGG - Intergenic
1185119668 22:48958502-48958524 CTGGACAATGGGACAGTGGGAGG - Intergenic
949677042 3:6467377-6467399 ATGAAGGAGGGGAGGGAGGGAGG + Intergenic
949954274 3:9254832-9254854 AGGAACGAAGGGAGGGAGGGAGG + Intronic
950293133 3:11803924-11803946 ATAAAAAGTGTGAGGGTGGGAGG + Intronic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
950545798 3:13637254-13637276 AGGAAGAATGGGAGGATGGCAGG + Intronic
950611510 3:14130020-14130042 AGGAACAAAGGAAGGGAGGGAGG - Intronic
951278612 3:20720109-20720131 ATGAAGATTTGGAGGGTAGGAGG + Intergenic
952307709 3:32160439-32160461 ATGGATGATGGGTGGGTGGGTGG + Intronic
952307739 3:32160545-32160567 ATGGATGATGGGTGGGTGGGTGG + Intronic
953062474 3:39438634-39438656 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
953360361 3:42290456-42290478 AAGAAGAAAGGGAGGGAGGGAGG - Intergenic
953574686 3:44103571-44103593 ATGTAGAATGGGAGGGAGAGGGG + Intergenic
954987629 3:54809659-54809681 AGGAACAAAGGAAGGGAGGGAGG - Intronic
956022412 3:64946710-64946732 ATGTATCCTGGGAGGGTGGGTGG - Intergenic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
956129166 3:66038371-66038393 ATGAACAAGCGGAGGCTTGGGGG - Intronic
956158641 3:66324679-66324701 ATGAACAAGGGCAGCTTGGGAGG + Intronic
956490637 3:69767782-69767804 ATGAAGAATGGGTTGGAGGGTGG + Intronic
956873818 3:73442970-73442992 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
957500127 3:81045233-81045255 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
957981398 3:87515966-87515988 ATGATAAATGGGTGGTTGGGTGG - Intergenic
958144897 3:89612158-89612180 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
958193266 3:90210412-90210434 ATGAAAGATGGGAGGGTGGGAGG + Intergenic
958256184 3:91328090-91328112 ATAAATAGTGGGGGGGTGGGTGG - Intergenic
958416571 3:93881356-93881378 ACGAAAGATGGGAGGGTGGGAGG + Intronic
959524872 3:107365556-107365578 AGGAAGGGTGGGAGGGTGGGAGG + Intergenic
959799696 3:110477622-110477644 ATGAAAAATGGGAGGCTGTTTGG - Intergenic
959965412 3:112348253-112348275 ATGCACCATGGGAGGATTGGAGG + Intronic
960040388 3:113144466-113144488 ATGAACAATGGTAGAGCTGGGGG - Intergenic
960126678 3:114006150-114006172 ATGAAAACTGGGAGAGTGGCCGG + Intronic
960152212 3:114261905-114261927 ATGCACAGAGGGAGGGAGGGGGG + Intergenic
960155430 3:114293202-114293224 ATGAATGAAGGGAGGGAGGGAGG + Intronic
961337135 3:126187323-126187345 AGGAAGGAAGGGAGGGTGGGAGG + Intronic
961394513 3:126577877-126577899 TTGCACACTGGGAGGCTGGGTGG + Intronic
961636088 3:128333995-128334017 AGGAAACATGGGAGGTTGGGAGG + Intronic
961821846 3:129579194-129579216 ATGAAGGATGGAAGGGAGGGAGG + Intronic
962340118 3:134575376-134575398 AGGAAAAAAGGGAGGGAGGGAGG - Intergenic
962340139 3:134575480-134575502 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
962340158 3:134575580-134575602 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
962416062 3:135183231-135183253 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
963928010 3:150972002-150972024 AGGAATAATGGGAGGGAGTGGGG + Intronic
964040209 3:152252280-152252302 AGGAACAAAGGGAGGGAGGGAGG - Intronic
964135868 3:153344401-153344423 ATGAAAATGGGGGGGGTGGGAGG - Intergenic
964246853 3:154663794-154663816 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
964742415 3:159980694-159980716 AAGACAAATGGGTGGGTGGGTGG + Intergenic
964920956 3:161894920-161894942 ATGAAAAATGCTAGTGTGGGAGG + Intergenic
965240207 3:166187400-166187422 CTGCACACTGGGAGGATGGGTGG - Intergenic
965424570 3:168506077-168506099 ATAAAGAAAGGGAGGGAGGGAGG - Intergenic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
965857479 3:173105764-173105786 ATGAAGACAGGGAGGGAGGGAGG - Intronic
967528551 3:190522341-190522363 AGGAACGAAGGGAGGGAGGGAGG - Intronic
967543054 3:190691391-190691413 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
967569181 3:191008148-191008170 ATAAAAAAAGGGAGGGAGGGAGG + Intergenic
968170553 3:196506215-196506237 ATGCATGCTGGGAGGGTGGGGGG + Intergenic
968189034 3:196654086-196654108 ATGAACAACTGGAGAGTGGACGG - Intronic
968594696 4:1476355-1476377 GTGAATGATGGGTGGGTGGGTGG + Intergenic
968594721 4:1476458-1476480 ATGATAAATGGGTGGGTGGATGG + Intergenic
968633548 4:1665820-1665842 ATGAAGAATGGGAGGGAGGGAGG + Intronic
968924740 4:3541326-3541348 ATGAAGAATGGATGGGTGGCTGG + Intergenic
968924814 4:3541619-3541641 ATGATGAATGGATGGGTGGGTGG + Intergenic
968931196 4:3580396-3580418 ATGATGAATGGAAAGGTGGGTGG - Intronic
969170623 4:5359813-5359835 ATGAATATTGGGAGAGTGGTAGG + Intronic
969436091 4:7190405-7190427 AGGAAGGATGGGAGGGTGGAAGG - Intergenic
969559884 4:7939982-7940004 GGGAACAAAGGGAGGTTGGGCGG + Exonic
969586142 4:8094920-8094942 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
969854294 4:9986593-9986615 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
970297157 4:14642202-14642224 AGGAAGGATGGGAGGGAGGGAGG + Intergenic
970690360 4:18612712-18612734 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
971034090 4:22674516-22674538 ATGAACAATGCTAGGTCGGGTGG - Intergenic
971174274 4:24265865-24265887 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
971769593 4:30879162-30879184 AGGAATAAAGGGAGGGAGGGAGG - Intronic
972319401 4:37959151-37959173 TTGAACAATGTGAGGGTTAGGGG + Intronic
972598929 4:40554761-40554783 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
972639812 4:40915184-40915206 AGGTAGATTGGGAGGGTGGGGGG - Intronic
972874682 4:43343713-43343735 AAGAAAAAAGGGAGGGAGGGAGG - Intergenic
973140173 4:46757304-46757326 ATGAAAGGTGGGAGGGTGGGAGG + Intronic
973542036 4:51944549-51944571 ATAGACAATGGGAAGGTGTGGGG + Intergenic
973826406 4:54711227-54711249 AGGAAAGATGGTAGGGTGGGTGG + Intronic
973968918 4:56191392-56191414 AGGAACAGAGGGAGGGAGGGAGG - Intronic
974333543 4:60510371-60510393 AGGAAGGAAGGGAGGGTGGGAGG + Intergenic
974860483 4:67514933-67514955 ATATATAATGGGTGGGTGGGTGG - Intronic
975180488 4:71338907-71338929 TTGGACAGAGGGAGGGTGGGTGG + Intronic
976984353 4:91274477-91274499 GGGAAAAATGGGTGGGTGGGTGG - Intronic
977004821 4:91552489-91552511 ATAAAGAATGAGAGGATGGGTGG + Intronic
977037505 4:91973830-91973852 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
977287691 4:95129387-95129409 AAGAAAAAAGGGAGGGAGGGAGG - Intronic
977911417 4:102541601-102541623 GTGAACAATGGGAGGGTCTATGG + Intronic
977913641 4:102565686-102565708 AGGAACGATGGGACGGAGGGAGG - Intronic
978071626 4:104479774-104479796 AGGAACAGAGGGAGGGAGGGAGG - Intronic
978277321 4:106967731-106967753 AGGAACAGAGGGAGGGAGGGAGG + Intronic
978311631 4:107390753-107390775 ATGAGGAATGGGAGGATGAGGGG + Intergenic
978469285 4:109045313-109045335 TTGAACAATGTGGGGGTGAGAGG - Intronic
979101138 4:116615634-116615656 AGGAAGGAAGGGAGGGTGGGAGG + Intergenic
979532589 4:121784941-121784963 AAGGACAATGGGTGGGTGGATGG + Intergenic
979557210 4:122062469-122062491 CTGAACAATGGGAGGGTTAGGGG - Intergenic
979886783 4:126036840-126036862 AGGAACGAAGGGAGGGAGGGAGG + Intergenic
980510860 4:133785766-133785788 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
980510867 4:133785790-133785812 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
982256136 4:153453296-153453318 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
982596728 4:157395046-157395068 AAGAAAGATGGGAGGGAGGGAGG + Intergenic
983180832 4:164646512-164646534 ATAAACAATGGGATGGAGGTTGG + Intergenic
983286653 4:165748543-165748565 ATGCTCCCTGGGAGGGTGGGAGG - Intergenic
983382162 4:167010062-167010084 ATAAACAATAAGTGGGTGGGGGG + Intronic
983462465 4:168045533-168045555 AGGCACAAGGGGATGGTGGGTGG - Intergenic
983962412 4:173770828-173770850 AGGAAGGAAGGGAGGGTGGGAGG - Intergenic
984635049 4:182101345-182101367 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
984824170 4:183909099-183909121 ATGAAGATTGGGAGAGTAGGTGG + Intronic
984922421 4:184777471-184777493 ATGTACAAAGAGAGGGAGGGAGG + Intronic
984960591 4:185093709-185093731 ATCAACAATGGGATGTAGGGTGG + Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985333537 4:188867861-188867883 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
985507392 5:291382-291404 ATGAACCATGTCAGTGTGGGTGG - Intronic
985507401 5:291449-291471 ATGAACCATGTCAGTGTGGGTGG - Intronic
985507442 5:291717-291739 ATGAACCATGTCAGTGTGGGTGG - Intronic
985844555 5:2334688-2334710 AAGAACAATGGAGGGGAGGGGGG - Intergenic
986313613 5:6571831-6571853 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
986374272 5:7114326-7114348 ATGAAGCATGGGAGGGTCGAGGG - Intergenic
986519365 5:8597523-8597545 ATGAACATTGGGAAGGAGGATGG + Intergenic
987067930 5:14308261-14308283 ATGAACAACGGGTGGTTAGGTGG - Intronic
987182224 5:15379803-15379825 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
987220509 5:15786267-15786289 ATGAAAGAAGGGAGGGAGGGAGG - Intronic
987331418 5:16860745-16860767 ATGAACGATGGGTGGGTGGAGGG + Intronic
988895259 5:35665432-35665454 AGGAACAGAGGGAGGGAGGGAGG + Intronic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989106949 5:37871924-37871946 GGGAACAATGGGAGGAAGGGGGG - Intergenic
989460254 5:41689500-41689522 CCAAAAAATGGGAGGGTGGGAGG - Intergenic
990797197 5:59556888-59556910 AGGAAGAAAGGGAGGGTGGCAGG + Intronic
992375217 5:76182061-76182083 ATGAACAATGAGAGGATAGGTGG - Intronic
993130625 5:83893635-83893657 AGAAGAAATGGGAGGGTGGGAGG + Intergenic
993282651 5:85946399-85946421 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
993375075 5:87141134-87141156 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
994406190 5:99348121-99348143 AGGAAAAATGAGAGGGTGGATGG + Intergenic
994913691 5:105945651-105945673 AGGAAGGATGGGAGGGAGGGAGG + Intergenic
994996068 5:107064446-107064468 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
995091910 5:108188121-108188143 ATGGTCATTGGGAGGGTAGGAGG + Intronic
995589070 5:113679724-113679746 ATAAAAGATGGGAGGCTGGGAGG - Intergenic
996087492 5:119320012-119320034 ATGAACCATGGGTTGGTGGTGGG + Intronic
996577983 5:124997708-124997730 AAGAAAAAAGGGAGGGAGGGAGG - Intergenic
996733571 5:126738519-126738541 TGGAAGACTGGGAGGGTGGGAGG - Intergenic
996942159 5:129021115-129021137 ATGAACAATGTGAGGTAGGCCGG - Intronic
1000126010 5:158244888-158244910 AAGAACAATGGGAAGGGGTGAGG - Intergenic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1000364988 5:160482164-160482186 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1000499283 5:162028734-162028756 AAGAAAAATGGGAGGAAGGGAGG + Intergenic
1001443588 5:171764703-171764725 ATGAAGGATGGGAGGCTGGAGGG - Intergenic
1001493148 5:172169496-172169518 CAGAAGAATGGGAGGGTGGGTGG + Intronic
1001511106 5:172322628-172322650 AGGAAGAAAGGAAGGGTGGGAGG - Intergenic
1002482624 5:179513315-179513337 AGGAAGAAAGGGAGGGAGGGGGG - Intergenic
1003031521 6:2605294-2605316 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1003442805 6:6159282-6159304 ATGGACCAAGGAAGGGTGGGTGG - Intronic
1003491747 6:6628285-6628307 AGGAAGAAGGGGAGGGAGGGAGG - Intronic
1003507630 6:6752547-6752569 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1004751380 6:18565795-18565817 ATGAAAAAAGGGAGGGAAGGAGG - Intergenic
1005498410 6:26409153-26409175 GTTAAGAAAGGGAGGGTGGGAGG + Intronic
1005841249 6:29745873-29745895 AGGAAAACTGGGAAGGTGGGAGG + Intergenic
1005855927 6:29863413-29863435 ATCCAGAATGTGAGGGTGGGTGG + Intergenic
1006059573 6:31410378-31410400 AAGAAAACTGTGAGGGTGGGAGG - Intronic
1006072062 6:31505449-31505471 AGGAAAACTGTGAGGGTGGGAGG - Intronic
1006112720 6:31758391-31758413 ATAAAGAATGGGATGGTGGGAGG + Intronic
1006152669 6:31997720-31997742 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006158977 6:32030457-32030479 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006632962 6:35442538-35442560 ATAAAAAAAGGGGGGGTGGGTGG - Intergenic
1006745426 6:36338408-36338430 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1007075628 6:39064534-39064556 GGGCACAATGAGAGGGTGGGGGG - Intronic
1007127544 6:39440120-39440142 ATGAACAGTGAGAAGGGGGGTGG + Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007190878 6:40017243-40017265 ATCAACAAAGGGGGGGTGGGGGG - Intergenic
1007352072 6:41281193-41281215 ATGATGAATGGGTGGATGGGTGG + Intronic
1007684301 6:43656077-43656099 AGAAACAAAGGGAGGGAGGGAGG - Intronic
1007866767 6:44979526-44979548 ATGAACAAAGTGTGTGTGGGGGG + Intronic
1008039710 6:46784053-46784075 ATGAATTTTGGGAGGATGGGTGG + Intergenic
1008117193 6:47565684-47565706 ATGAATCATGGTAGGGTGCGAGG - Intronic
1008644504 6:53500239-53500261 ATCATCAATGGGAAGGTAGGAGG - Exonic
1008795350 6:55296056-55296078 ACAAAAGATGGGAGGGTGGGTGG - Intergenic
1008913846 6:56764964-56764986 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1009704946 6:67238604-67238626 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1009856720 6:69274484-69274506 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1010215112 6:73394608-73394630 ATACACAGTGGGGGGGTGGGGGG + Intronic
1010389670 6:75322389-75322411 TTGAAGAATGGGAAGGTGAGCGG - Intronic
1010443678 6:75927726-75927748 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1010873027 6:81064757-81064779 ATGCATACTGGGAGGATGGGAGG - Intergenic
1011485711 6:87839472-87839494 ATAAACAATGGGGGGATGAGGGG - Intergenic
1011729696 6:90248619-90248641 ATGAAAAGTGGGAGGTGGGGTGG + Intronic
1011970024 6:93211340-93211362 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1013589297 6:111606599-111606621 ATAACCACTGGGGGGGTGGGGGG + Intergenic
1013872448 6:114782019-114782041 TTGAACAATGGGAGAGTTAGGGG - Intergenic
1013979090 6:116108841-116108863 ATGAAGAAAGAGAGGGTGGTGGG - Intronic
1016360356 6:143260909-143260931 ATGAGCAAAGGGATGGCGGGGGG - Intronic
1016546293 6:145228238-145228260 ATAAATAATGGAAGGCTGGGTGG + Intergenic
1017018690 6:150122693-150122715 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1017473637 6:154765892-154765914 ATGAACAATGGGAGGTTTAGGGG + Intronic
1017523895 6:155226161-155226183 ATGAAGAATGGGATGGGGGCAGG - Intronic
1017567113 6:155699331-155699353 AAGAATAAAGGAAGGGTGGGAGG - Intergenic
1017755070 6:157522732-157522754 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1018651739 6:165998164-165998186 AGGAAGAATGGAAGGGAGGGAGG + Intergenic
1019651956 7:2164585-2164607 AGGAAAAATGGGGGGGGGGGGGG + Intronic
1019883465 7:3883705-3883727 CTAGACAATGGGAGGGAGGGAGG - Intronic
1020464171 7:8457637-8457659 ATGAACAATGGGAGAATGCCAGG - Intronic
1021329922 7:19323918-19323940 TGGAACAAAGGGAGGGAGGGAGG + Intergenic
1021760700 7:23900780-23900802 ATAAATAAAGGGAGGGAGGGAGG - Intergenic
1022061141 7:26796887-26796909 ATGAACAATGTGAGGGTTTAGGG - Intronic
1022109251 7:27218225-27218247 AGAAACAAAGGGAGGATGGGAGG - Intergenic
1022110878 7:27230694-27230716 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1022363562 7:29685754-29685776 ACGAAGAATGGGAGGGAGGGAGG + Intergenic
1022697814 7:32727990-32728012 ACGAAGAATGAGAGGGAGGGAGG - Intergenic
1023373680 7:39535694-39535716 ACAACCAATAGGAGGGTGGGAGG - Intergenic
1024407181 7:48995148-48995170 TTGAACAATGAGGGGGTCGGGGG + Intergenic
1025215874 7:57055761-57055783 ATGAAAGGTGGGAGGCTGGGAGG + Intergenic
1025655506 7:63514941-63514963 ATGAAAGGTGGGAGGCTGGGAGG - Intergenic
1025718471 7:63986134-63986156 AGGATGAATGGGAGGGAGGGAGG + Intergenic
1025790007 7:64680373-64680395 CTGAAGAATGGGAGGGTGTTTGG + Intronic
1026166862 7:67917909-67917931 CTGAAAGGTGGGAGGGTGGGTGG - Intergenic
1026464856 7:70645226-70645248 ATGAATGAGGGGAGGTTGGGAGG - Intronic
1026666577 7:72345550-72345572 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1026870575 7:73848811-73848833 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1026967412 7:74449008-74449030 ATGAAGGAAGGGAGGGAGGGAGG - Intergenic
1027367806 7:77476668-77476690 ATAAAAGGTGGGAGGGTGGGAGG + Intergenic
1027473021 7:78596173-78596195 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1027473033 7:78596206-78596228 ATGAAGGAAGGGAGGGAGGGAGG + Intronic
1027522680 7:79229946-79229968 CTGAAGACTGTGAGGGTGGGGGG - Intronic
1027688957 7:81317657-81317679 AGGAACAAAGGGAGGGAGGGAGG + Intergenic
1028202764 7:87981518-87981540 ATGAAGAATGGGAGGTGGTGTGG + Intronic
1029141607 7:98414766-98414788 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1029953492 7:104612372-104612394 ATAATGAATGGGTGGGTGGGTGG + Intronic
1030497846 7:110321572-110321594 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1030608880 7:111667617-111667639 ATGCACAATGGGAGGGGATGAGG - Intergenic
1031153663 7:118083972-118083994 ATGAAAAAGGTCAGGGTGGGTGG + Intergenic
1031446123 7:121857020-121857042 TTGAAGAATGGGAGGGAGGGAGG + Intergenic
1031871166 7:127091435-127091457 ATGACCAGTGGGATGGTGGTGGG - Intronic
1031871187 7:127091501-127091523 ATGACCAGTGGGATGGTGGTGGG - Intronic
1031871198 7:127091528-127091550 ATGACCAGTGGGATGGTGGTGGG - Intronic
1031871352 7:127092009-127092031 ATGACTAGTGGGATGGTGGGGGG - Intronic
1031995268 7:128226487-128226509 ATGGACAATAGGAGGATGGAAGG - Intergenic
1031995273 7:128226510-128226532 ATGGACAATAGGAGGATGGAAGG - Intergenic
1033597054 7:142865870-142865892 AGGAGCCAGGGGAGGGTGGGTGG - Intronic
1033599674 7:142879953-142879975 ATGAACAATTGGCGGGCTGGGGG - Intronic
1034429496 7:151034060-151034082 ATCAACACTGGGTGGCTGGGTGG + Intronic
1034608902 7:152346622-152346644 TTGAACAATGAGAGGGTTAGGGG + Intronic
1034837147 7:154363052-154363074 AAGAACAATGGGTGGAGGGGAGG - Intronic
1034855783 7:154545424-154545446 ATGAAGAAAAGGAGGGAGGGAGG - Intronic
1034972689 7:155428894-155428916 ATGAACACAGGGAGTGTGGCTGG - Intergenic
1035247922 7:157576940-157576962 GTTAACACTGGGAAGGTGGGAGG - Intronic
1035289705 7:157830056-157830078 AAGGACAGTGGGAGGGAGGGTGG - Intronic
1035341918 7:158167670-158167692 ATGAGCAGTGTCAGGGTGGGAGG - Intronic
1035404639 7:158589029-158589051 TTGAAGGATGGGAGGGTGAGGGG - Intergenic
1035454400 7:158998695-158998717 ATGAAGATGGGGAGTGTGGGGGG - Intergenic
1036385905 8:8281399-8281421 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1036387334 8:8293956-8293978 TGGGAAAATGGGAGGGTGGGTGG + Intergenic
1036479106 8:9122029-9122051 ATGAACTAAGGGCGTGTGGGAGG + Intergenic
1036961126 8:13245514-13245536 AGGAAGAATGAGAGGGTGAGAGG - Intronic
1037460999 8:19109590-19109612 AGGAAAAAAGGGAGGGAGGGAGG - Intergenic
1037519359 8:19664879-19664901 ATTACTAATGGGAGGATGGGGGG + Intronic
1037598704 8:20375335-20375357 AGGAAGAAAGGAAGGGTGGGTGG - Intergenic
1037747933 8:21661601-21661623 AGGAAAAAAGGGAGGGAGGGAGG + Intergenic
1037806865 8:22062805-22062827 AGAAAGAATGGGAGGGAGGGAGG - Intronic
1038170510 8:25127425-25127447 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1038190362 8:25314560-25314582 ATGATAGATGGGTGGGTGGGTGG - Intronic
1038389613 8:27183211-27183233 ATGATTAATTGGGGGGTGGGTGG + Intergenic
1038950480 8:32408884-32408906 CAGAAAGATGGGAGGGTGGGAGG - Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039336317 8:36594310-36594332 AGGAAGAATGGAAGGGTGGGAGG - Intergenic
1039352959 8:36782325-36782347 ATGAACGGAGGGAGGGAGGGAGG - Intergenic
1039726401 8:40221564-40221586 ATGAACAGTGGGAGACAGGGAGG - Intergenic
1039779544 8:40770505-40770527 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1040017752 8:42713668-42713690 CGGAAGAGTGGGAGGGTGGGAGG - Intronic
1041103588 8:54420245-54420267 ATGAACCATGGTAGCGTGAGTGG + Intergenic
1041675989 8:60540474-60540496 AAGAAGAAAGGGAGGGAGGGAGG - Intronic
1042102012 8:65283962-65283984 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1042397645 8:68310875-68310897 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1042684151 8:71418804-71418826 GGCAACAATGGGAGGGAGGGAGG + Intronic
1043313040 8:78886195-78886217 AGGAAGAAAGGGAGGGTGGGAGG - Intergenic
1043313071 8:78886283-78886305 AGGAAGAAAGGGAGGGTGGGAGG - Intergenic
1044526926 8:93262689-93262711 ATGCACAATGTGAGGTTGAGGGG + Intergenic
1046441672 8:114263107-114263129 TGGATCATTGGGAGGGTGGGAGG - Intergenic
1046457707 8:114488994-114489016 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047306827 8:123659324-123659346 ATGGACAATGGATGGATGGGTGG - Intergenic
1047593445 8:126351682-126351704 GTTAACACTGGGTGGGTGGGTGG + Intergenic
1047767750 8:128003214-128003236 AGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1048175175 8:132145742-132145764 ATGAAGAATGGGAGGTTGACAGG + Intronic
1048525466 8:135198352-135198374 ATGAAAAATCAGAGGGAGGGAGG + Intergenic
1049186267 8:141255767-141255789 ATGAAAAGTAGGAGGCTGGGTGG + Intronic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050709854 9:8449250-8449272 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1050831353 9:10018160-10018182 AGGAAGAATGTGAGGGAGGGAGG + Intronic
1050977294 9:11956332-11956354 ATGAACAATGGGAAGGGGCATGG + Intergenic
1051233655 9:14977564-14977586 AGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1051322130 9:15916577-15916599 AGGAACAATGGGATAGTTGGGGG - Intronic
1051339655 9:16099897-16099919 ATGGCCAGTGAGAGGGTGGGTGG - Intergenic
1051529524 9:18084704-18084726 GAAAGCAATGGGAGGGTGGGAGG - Intergenic
1052359042 9:27534611-27534633 AGGAAGGAAGGGAGGGTGGGAGG + Intergenic
1052642346 9:31184989-31185011 ATGGCAAAAGGGAGGGTGGGAGG + Intergenic
1053799813 9:41757301-41757323 ATGAAGAATGGATGGGTGGCTGG + Intergenic
1054145324 9:61557339-61557361 ATGATGAATGGATGGGTGGGTGG - Intergenic
1054145398 9:61557632-61557654 ATGAAGAATGGATGGGTGGCTGG - Intergenic
1054188221 9:61969356-61969378 ATGAAGAATGGATGGGTGGCTGG + Intergenic
1054188292 9:61969640-61969662 ATGATGAATGGATGGGTGGGTGG + Intergenic
1054454253 9:65421413-65421435 ATGGATAATGGATGGGTGGGTGG + Intergenic
1054458959 9:65451674-65451696 ATGATGAATGGAAAGGTGGGTGG + Intergenic
1054465080 9:65488492-65488514 ATGATGAATGGATGGGTGGGTGG - Intergenic
1054465142 9:65488749-65488771 ATGAAGAATGGATGGGTGGCTGG - Intergenic
1054650222 9:67618936-67618958 ATGATGAATGGATGGGTGGGTGG - Intergenic
1054650293 9:67619220-67619242 ATGAAGAATGGATGGGTGGCTGG - Intergenic
1055078972 9:72248128-72248150 ATAAACAATCTGAGGGTTGGGGG + Intronic
1055887950 9:81086920-81086942 CTGAAGAATTGGAGGTTGGGGGG + Intergenic
1057643413 9:96850488-96850510 ACCAAGAAGGGGAGGGTGGGAGG + Intronic
1057802455 9:98198572-98198594 CTGAAAAATGGGTGGTTGGGAGG - Intergenic
1057903027 9:98964202-98964224 ACCAAGAATGGGGGGGTGGGAGG - Intronic
1058049187 9:100389459-100389481 AAGAACAAAGGGAAGGTTGGAGG - Intergenic
1058717960 9:107739268-107739290 AGGAAGAAAGGGAGGGTGGGAGG - Intergenic
1058960458 9:109988542-109988564 AGGAAGAAAGGGAGGGAGGGAGG + Intronic
1059252165 9:112895570-112895592 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1059252177 9:112895613-112895635 ATGAATGATGGGTGGGTGGGTGG - Intergenic
1059252194 9:112895676-112895698 ATGGATGATGGGTGGGTGGGTGG - Intergenic
1059252207 9:112895734-112895756 ATGGATAATGGGTGGGTGGATGG - Intergenic
1059366305 9:113789149-113789171 AGGAAGGAAGGGAGGGTGGGAGG - Intergenic
1059918955 9:119136371-119136393 ATAAAAAATGGGGGGGGGGGCGG + Intergenic
1060372398 9:123086690-123086712 AGGGAGAAAGGGAGGGTGGGAGG + Intronic
1061135060 9:128729149-128729171 AGGAACAAGGGTAGAGTGGGAGG - Intergenic
1061245122 9:129397615-129397637 AGGAAGAATAGGAGGGTGGATGG + Intergenic
1061256567 9:129456968-129456990 ATGAATGATGGATGGGTGGGTGG + Intergenic
1061890780 9:133618002-133618024 ATGGCCAATGGGAGGGAGGGAGG + Intergenic
1061940338 9:133880521-133880543 ATGAAGAAGGGGTGGGTGCGGGG + Intronic
1062052038 9:134452363-134452385 ATGAATTCTGGGTGGGTGGGTGG - Intergenic
1062520861 9:136957313-136957335 TTGGATAATGGGTGGGTGGGTGG + Intronic
1185611490 X:1395983-1396005 ATAATGAATGGGTGGGTGGGTGG + Intergenic
1185623378 X:1466715-1466737 AGGAACTAAGGGAGGGAGGGAGG - Intronic
1185624472 X:1472712-1472734 ATGAATGGTGGGTGGGTGGGTGG + Intronic
1185700490 X:2227713-2227735 AGGAAGGATGGGAGGGAGGGAGG + Intronic
1185918126 X:4058855-4058877 AAGAATGAAGGGAGGGTGGGAGG + Intergenic
1186506675 X:10099155-10099177 ATGAAGACTGGAAGGGAGGGAGG - Intronic
1186712437 X:12213421-12213443 ATGAAAGTTGGGTGGGTGGGTGG + Intronic
1186933070 X:14416056-14416078 CTGAAGGTTGGGAGGGTGGGAGG + Intergenic
1188077362 X:25794622-25794644 AAGAAAAATGGAAGGGAGGGAGG - Intergenic
1188947721 X:36327938-36327960 ATAAACACTGTGAGGGTGGGAGG + Intronic
1189169149 X:38892186-38892208 ATGAACAAAGGAAGTGGGGGAGG - Intergenic
1189457650 X:41207846-41207868 ATGAGAGATGGGAGGGAGGGTGG - Intronic
1189931593 X:46017819-46017841 AGGAAGGAAGGGAGGGTGGGAGG - Intergenic
1190128059 X:47723375-47723397 TTGAACAGTGGACGGGTGGGTGG - Intergenic
1190176695 X:48156462-48156484 ATGCACTGTGGGGGGGTGGGTGG - Intergenic
1190616140 X:52234546-52234568 TTGAAGGATGGGAAGGTGGGAGG - Intergenic
1191920153 X:66246903-66246925 TTCAAAAATGAGAGGGTGGGAGG - Intronic
1192169419 X:68844950-68844972 AAGAGATATGGGAGGGTGGGAGG + Intergenic
1192238876 X:69314119-69314141 ATCAGCAATGGGAGGGATGGGGG - Intergenic
1192360668 X:70436796-70436818 ATGAAGAGAGAGAGGGTGGGAGG + Intergenic
1192430335 X:71107446-71107468 AGGAACAATCGGAGGGTAGATGG + Exonic
1192579171 X:72266765-72266787 GAGAAAAAAGGGAGGGTGGGGGG - Intronic
1193427165 X:81353853-81353875 ATGAAGAATGGGAGGGGTGTGGG - Intergenic
1193864717 X:86717240-86717262 ATAAACAATGGAAAGGTGAGGGG - Intronic
1193945882 X:87733757-87733779 ATCAAGAATAGGAGGGTGGGAGG + Intergenic
1194754758 X:97725475-97725497 ATGAAAAATGGTGTGGTGGGGGG + Intergenic
1195130021 X:101842324-101842346 AGGAAGAAAGGGAGGGAGGGAGG - Intronic
1195897912 X:109767118-109767140 ATGAAGGAAGGGAGGGAGGGAGG + Intergenic
1195997999 X:110750679-110750701 ATGAACAATGGGCGGGGTAGAGG + Intronic
1196398255 X:115288878-115288900 AAGAAGAAAGAGAGGGTGGGAGG + Intergenic
1196812533 X:119640144-119640166 CTGGATAGTGGGAGGGTGGGAGG - Intronic
1197090822 X:122534484-122534506 AAGAGTAATGGGAGGTTGGGGGG + Intergenic
1197175982 X:123486154-123486176 AAGAAGAAAGGGAGGGAGGGAGG + Intronic
1199771733 X:150979531-150979553 GGGAACTGTGGGAGGGTGGGTGG + Intergenic
1200082608 X:153585926-153585948 AAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1200100392 X:153687150-153687172 AGGAACACGGGGTGGGTGGGGGG + Intronic
1200986772 Y:9309269-9309291 ATGAAGAAAGGAAGGGAGGGAGG + Intergenic
1201901247 Y:19047335-19047357 GTGACCAATGGGTGGGTGGATGG + Intergenic
1201942810 Y:19477942-19477964 ATGTACCATGGGAGGGAGTGGGG + Intergenic