ID: 1070119546

View in Genome Browser
Species Human (GRCh38)
Location 10:73562396-73562418
Sequence TGTGTTCTGTAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070119546 Original CRISPR TGTGTTCTGTAGAAGGTGGA GGG (reversed) Intronic
900730419 1:4255317-4255339 TATGTACTCTAGAAGGTGGAAGG + Intergenic
900968490 1:5976074-5976096 AGTGTTCTGTAGAATGCTGAGGG - Intronic
902630207 1:17700375-17700397 TGTGCTCTGGAGAAGGGGGATGG + Intergenic
904148953 1:28420412-28420434 TGTCTTCTTTACAAGGTGGCAGG - Intronic
905311582 1:37052612-37052634 TGAGTTCAATGGAAGGTGGAAGG - Intergenic
905323733 1:37135438-37135460 TGATTTCTGCAAAAGGTGGATGG + Intergenic
908385497 1:63637409-63637431 TGTTTTCTGTAGAGGGGAGATGG + Intronic
908755597 1:67466438-67466460 TGTGCTGTGTAGAAGGAAGATGG + Intergenic
908920117 1:69180125-69180147 TGAGTTATGGTGAAGGTGGAGGG - Intergenic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
909826492 1:80133713-80133735 TGATTTTTGTAGAAGGTGTAAGG + Intergenic
909845996 1:80395517-80395539 TGATTTTTGTAGAAGGTGTAAGG + Intergenic
911179061 1:94844937-94844959 TGGGTTCTGTGGGATGTGGAGGG + Intronic
912431190 1:109629312-109629334 AGGGTTCTGTATTAGGTGGATGG + Exonic
913595910 1:120376474-120376496 TGTGTTTTGTAAAAGCTAGAAGG - Intergenic
914091370 1:144502502-144502524 TGTGTTTTGTAAAAGCTAGAAGG + Intergenic
914096522 1:144548781-144548803 TGAGTTTTGTATAAGGTGTAAGG + Intergenic
914307235 1:146431687-146431709 TGTGTTTTGTAAAAGCTAGAAGG - Intergenic
914370502 1:147020305-147020327 AGTGATCTGTGGGAGGTGGAGGG + Intergenic
914412377 1:147443256-147443278 TGAGTTTTGTATAAGGTGTAAGG - Intergenic
914484192 1:148093105-148093127 AGTGATCTGTGGGAGGTGGAGGG - Intergenic
914594871 1:149141434-149141456 TGTGTTTTGTAAAAGCTAGAAGG + Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
915699826 1:157781272-157781294 TGGGTTTTCCAGAAGGTGGATGG + Intergenic
915809419 1:158890941-158890963 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
915815094 1:158957579-158957601 TGATTTTTGTAGAAGGTGTAAGG - Intronic
915840253 1:159207492-159207514 GGTATTGTGTGGAAGGTGGAAGG - Intergenic
916177664 1:162056054-162056076 TGTGTTCTGTAAAATGGGGGTGG + Intergenic
916376176 1:164155686-164155708 TTTGCTCTGTGTAAGGTGGAGGG - Intergenic
916487643 1:165273587-165273609 TGTGTTTGGTGGAGGGTGGAGGG - Intronic
917245397 1:172995634-172995656 TGTGTTGAGGAGAAGGTTGAAGG - Intergenic
918278755 1:182981724-182981746 TGAGTTTTGTATAAGGTGTAAGG + Intergenic
920711226 1:208296803-208296825 TGTCTTCTGGAGAAGGGGGTGGG + Intergenic
920832704 1:209479691-209479713 TTTGTTTTTTACAAGGTGGAAGG - Intergenic
921184063 1:212655302-212655324 TGTCTTCATTAGAGGGTGGAAGG - Intergenic
921520338 1:216149043-216149065 GTTGTTCTGTAGAAGGTGCTTGG - Intronic
922875567 1:228937352-228937374 TGTTTTCTGAAGAAGGTGAGGGG + Intergenic
923226990 1:231947431-231947453 TGATTTCTGTACAAGGTGTAAGG - Intronic
923797320 1:237170371-237170393 TATCCACTGTAGAAGGTGGAAGG + Intronic
924483191 1:244454782-244454804 TGTGTTCTGTAGTGGATAGATGG + Intronic
1062782577 10:228736-228758 AGTGTTATGTAGAAGGGGAAAGG + Intronic
1062790517 10:301395-301417 TGGGGTCTGGGGAAGGTGGAGGG + Intronic
1065184029 10:23155293-23155315 TCTGTTCTGTAGCTGATGGAAGG + Intergenic
1066812277 10:39355625-39355647 TGTTTTTTGTATAAGGTGTAAGG + Intergenic
1067680733 10:48437901-48437923 TGTGTTGTCTAAAAGATGGAGGG + Exonic
1067922026 10:50468970-50468992 TGTGTTGGGTAAAGGGTGGAGGG + Intronic
1070016568 10:72539265-72539287 TGTATTCTGTAGCAGTTGGATGG - Intronic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1070570263 10:77636014-77636036 TGTGCCCTGTAGAAGTTTGAGGG + Intronic
1071087328 10:81877837-81877859 TGTGTTTTGTAGAAGGATAAAGG + Intronic
1071286880 10:84157016-84157038 AGCTCTCTGTAGAAGGTGGAAGG - Intergenic
1073121011 10:101122620-101122642 TGTGTTGTGGAGAGGGTGGGGGG + Intronic
1073717609 10:106125563-106125585 TATGTACTGAAGCAGGTGGATGG - Intergenic
1073979317 10:109136377-109136399 TATGTTTTGTATAAGGTGTAAGG - Intergenic
1074500347 10:114017976-114017998 TCTATTCTGTAGGAAGTGGAGGG - Intergenic
1074947546 10:118296095-118296117 TGGATTCTGTAGAAGGGTGAGGG - Intergenic
1075317561 10:121465142-121465164 TGAGTTATGTAGAAGGAGGGTGG - Intergenic
1076288726 10:129327133-129327155 TGTGGTGTGTGTAAGGTGGAAGG + Intergenic
1076409740 10:130237767-130237789 TTTGTTTTGTATAAGGTGTAAGG + Intergenic
1077273443 11:1692513-1692535 TGTGTTCAGGTGAAGGCGGAGGG + Intergenic
1077513085 11:2981858-2981880 TGTATTCTGCAGAAGGTGACGGG - Intronic
1077513403 11:2984617-2984639 TGTATTCTGCAGAAGGTGACGGG - Intronic
1078451360 11:11443241-11443263 TGAGTTGTGGAGAAGGAGGATGG - Intronic
1078762290 11:14260940-14260962 GGTGTTCTGTAGACGGTAGTGGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1080871292 11:36239440-36239462 TGTCTTCACTTGAAGGTGGAAGG - Intergenic
1080915742 11:36656827-36656849 TGTGTTCTGTAGAGGGAGTCGGG + Intronic
1081571462 11:44294012-44294034 AGAGCTCTGTAGACGGTGGAGGG - Intronic
1082579253 11:54846275-54846297 TGATTTTTGTAGAAGGTGTAAGG + Intergenic
1084278304 11:68068213-68068235 TGTGTGGTGCAGAAGGGGGAAGG + Intronic
1084548445 11:69826119-69826141 TGAGCTCTGGAGCAGGTGGACGG + Intergenic
1085007388 11:73105360-73105382 GGTGTACTGTAGACAGTGGAAGG - Intronic
1085761402 11:79244319-79244341 TGTGTTCTGAAGAAGGAGTTAGG + Intronic
1085971764 11:81600345-81600367 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
1086332634 11:85769373-85769395 TGTGTTTTGAAGATGGAGGAAGG + Intronic
1086550410 11:88046681-88046703 TGTGTTTTGTAGAAGGTGTTGGG - Intergenic
1087217976 11:95515149-95515171 TGTGTTGTGTAAAAGTTGAAAGG + Intergenic
1087877298 11:103373653-103373675 TGTATTCTGTAGCTGTTGGATGG + Intronic
1089032104 11:115342395-115342417 TGTGTCCTGAAGGAGATGGAAGG + Intronic
1091049552 11:132355080-132355102 TGTGTTTTGAAGATGGAGGAAGG - Intergenic
1091091838 11:132778324-132778346 GGTGTAAAGTAGAAGGTGGAGGG - Intronic
1091612568 12:2023818-2023840 GGTGTTCTGAAGAAGGTGTTGGG - Intronic
1091686890 12:2568794-2568816 TGGGTTCTGGAGATGGAGGATGG + Intronic
1092627727 12:10345605-10345627 TGATTTCTGTATAAGGTGTAAGG + Intergenic
1093372894 12:18386064-18386086 TTGGTTCTGTGGAAGGAGGAGGG - Intronic
1093812632 12:23508236-23508258 GTTGTTCTGTAGAAGGTGCTGGG + Intergenic
1094417867 12:30236321-30236343 AGTGTTCTGTTGGAGGTGGATGG + Intergenic
1095251399 12:39983152-39983174 TGAGTTTTGTATAAGGTGTAAGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1099679579 12:85807708-85807730 TCTGTTCTATAGAAGGTCAAGGG + Intronic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1101956876 12:109219577-109219599 ATGGTTCTGTAGTAGGTGGAAGG + Intronic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1104755448 12:131266591-131266613 TGTGTTTTCAAGAAGGTGGGAGG - Intergenic
1105349837 13:19605169-19605191 TGTGTTTTGTAAAAGGTGTAAGG + Intergenic
1105471622 13:20700359-20700381 TGTGGTCTGTGGAAGGTGTGAGG + Intergenic
1107519330 13:41163596-41163618 TGTGTTTTGTAAAGGGAGGAGGG - Intergenic
1108253393 13:48588780-48588802 TGTGTTCTACAGAAGGTGGCTGG - Intergenic
1109381791 13:61571107-61571129 TATCTTTTGAAGAAGGTGGAAGG - Intergenic
1109465491 13:62726710-62726732 TAATTTCTGTAGAAGGTGTAAGG + Intergenic
1111786759 13:92796633-92796655 TTTGTTTTGAATAAGGTGGATGG - Intronic
1112378437 13:98865682-98865704 TGGGCTCTGTACCAGGTGGAAGG + Intronic
1116056878 14:39874834-39874856 TGTGTTCCTTACCAGGTGGAAGG - Intergenic
1116246693 14:42424243-42424265 TGTCTTCTGTGGAAGGCAGAAGG + Intergenic
1116397029 14:44458842-44458864 TGTATTCTGTAGCTGTTGGATGG - Intergenic
1118289417 14:64505466-64505488 TTTGTTCAGTAAAAAGTGGAAGG + Intronic
1118395243 14:65330591-65330613 TGTGTTTTGTTGATGGTAGAAGG + Intergenic
1118778093 14:68986459-68986481 TGTGTTGTGGGGGAGGTGGAGGG - Intergenic
1122628498 14:103096873-103096895 TGTGATCAGGTGAAGGTGGATGG + Intergenic
1125546968 15:40512908-40512930 TTTGTTCTGTAGACTGTGGCAGG - Intergenic
1126955207 15:53926170-53926192 TGCTTTCTGAAGAAGGTGTAGGG + Intergenic
1127356606 15:58206932-58206954 TGTGTAGTGTTGAGGGTGGAAGG - Intronic
1128873115 15:71178965-71178987 TGATTTTTGTATAAGGTGGAAGG - Intronic
1129430901 15:75501175-75501197 TGTGTTCTGAATAAGATGCAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1134500928 16:14768669-14768691 TCTGTTCTGTGGAAGGTTGTGGG - Intronic
1134579654 16:15360380-15360402 TCTGTTCTGTGGAAGGTTGTGGG + Intergenic
1134715050 16:16353818-16353840 TCTGTTCTGTGGAAGGTTGTGGG - Intergenic
1134722928 16:16397179-16397201 TCTGTTCTGTGGAAGGTTGTGGG - Intergenic
1134944500 16:18314692-18314714 TCTGTTCTGTGGAAGGTTGTGGG + Intergenic
1134951765 16:18354841-18354863 TCTGTTCTGTGGAAGGTTGTGGG + Intergenic
1135674254 16:24401990-24402012 TGTGTTGAGGAGAAGGGGGAGGG - Intergenic
1136701732 16:32150579-32150601 TGATTTCTGTATAAGGTGTAAGG - Intergenic
1136765931 16:32776883-32776905 TGATTTCTGTATAAGGTGTAAGG + Intergenic
1136802167 16:33093495-33093517 TGATTTCTGTATAAGGTGTAAGG - Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1139164382 16:64548741-64548763 AGGGTTCTGTAGGAGGAGGAAGG - Intergenic
1139207088 16:65039535-65039557 TAATTTCTGTAGAAGGTGTAAGG - Intronic
1141187100 16:81795866-81795888 TCTGTTCAATAGAAGGTGGGAGG - Intronic
1141268661 16:82519727-82519749 TGTGCTCTGAAGATGGAGGAAGG + Intergenic
1141791403 16:86238121-86238143 TGATTTTTGTATAAGGTGGAAGG - Intergenic
1203068318 16_KI270728v1_random:1039131-1039153 TGATTTCTGTATAAGGTGTAAGG + Intergenic
1142508873 17:381967-381989 GGTGCTCTGTAGACAGTGGAAGG - Intronic
1142893358 17:2959276-2959298 TGTGTTGTGTAGAGGCTGCAGGG + Intronic
1144130569 17:12242801-12242823 TGTGTTCTACACAAAGTGGAGGG - Intergenic
1144370477 17:14585504-14585526 TTTTTTCTGTAGGAGGTGGGAGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1149539878 17:57460849-57460871 TGTGTTCTGAGGAGGGTGGCAGG + Intronic
1151707191 17:75775409-75775431 TGTGTCCTCAAGAAGGTGGCTGG + Intergenic
1152552061 17:81034945-81034967 TGGGTTCCGGAGAAGGGGGAGGG - Intergenic
1152978625 18:250352-250374 TGTGGAGTGTTGAAGGTGGAAGG - Intronic
1153557064 18:6326042-6326064 TGTGATCTAATGAAGGTGGATGG - Intronic
1153696718 18:7650838-7650860 TGGTTTTTGTAGAAGGTGTAAGG - Intronic
1153895843 18:9558888-9558910 TGTGTTCTGTTGAAAGGGGTTGG + Intronic
1154517648 18:15190476-15190498 TGATTTCTGTATAAGGTGTAAGG - Intergenic
1155574426 18:27229230-27229252 TGTGTGGTGTGGGAGGTGGAAGG - Intergenic
1156282360 18:35652377-35652399 TGTTTTCTGCAGTATGTGGAAGG + Intronic
1156520431 18:37717718-37717740 AGGGTTCTGTAGAAGGTGGCAGG - Intergenic
1156740388 18:40319730-40319752 TGTGTTTTGTAGACAGTGTAAGG - Intergenic
1157496842 18:48162234-48162256 TGTTTCCGGTAGAAGGTAGAAGG - Intronic
1157908116 18:51587654-51587676 AATGTGCTGTACAAGGTGGATGG + Intergenic
1158173687 18:54628733-54628755 TGGGTTTTGAAGAAGATGGATGG + Intergenic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1160570435 18:79813582-79813604 TGATTTGTGTAGCAGGTGGAAGG - Intergenic
1161723979 19:5918027-5918049 TGTGTTCTGCAGAAGGCAGGAGG - Intronic
1161878201 19:6928242-6928264 TGTGTTCTGAAGGAGGAGCAAGG + Intronic
1161956248 19:7497075-7497097 TGGGGTGTGTAGAAGGTAGAGGG + Intronic
1164821374 19:31254022-31254044 TCTGTTCTGTAGATGGGGGTGGG - Intergenic
1165815042 19:38636814-38636836 TGGGTGCTGTAGCAGGTGGCTGG + Intronic
1165819564 19:38665944-38665966 TGTGTGATGTAGAAGCAGGAAGG + Intronic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166761681 19:45228150-45228172 TGTGTGAGGTAGGAGGTGGAGGG - Exonic
1167218284 19:48179960-48179982 GGTGGTCTCTAGAAGCTGGAAGG - Intronic
1168277724 19:55286456-55286478 GGGGTTCAGGAGAAGGTGGAGGG + Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925353858 2:3223450-3223472 TGTGTGCTGACGAAGGAGGAGGG + Intronic
925604595 2:5645822-5645844 TGTGTTTTGTAAAAGCTAGAAGG - Intergenic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
927133472 2:20080083-20080105 GGAGTACTGTGGAAGGTGGAGGG - Intergenic
927975802 2:27337279-27337301 TGTTTTCTGTACAACGTGAAGGG - Exonic
930487160 2:52024321-52024343 GTTGTTCTGTAGAAGGTGCTGGG + Intergenic
930913649 2:56661471-56661493 TGAGTTTTGTATAAGGTGTAAGG + Intergenic
932533158 2:72559965-72559987 TGTGTTCTTCAGAAGTTGGCTGG - Intronic
933364361 2:81330609-81330631 AGTGTTTTGTAGAGGGTGGAAGG - Intergenic
934513833 2:94971601-94971623 TGTTGCCTGTAGAAGGTGGGAGG - Intergenic
935839098 2:107089451-107089473 AGTTTTCTGGAGAAGGTGGTGGG - Intergenic
936501927 2:113073393-113073415 TGTGTCCTGGACAAGGTGGGTGG + Intronic
937031907 2:118747789-118747811 GGTGTTCTGTGCAAGGTGGGAGG - Intergenic
944415463 2:199475412-199475434 TGTGTGCTGGAGTAGGGGGAAGG + Intergenic
944815205 2:203369142-203369164 GGTTTTCTGTAGAAGGAGGGAGG + Intronic
945185878 2:207139128-207139150 TGTTTTCTAGAGAAGATGGATGG - Intronic
945520444 2:210820989-210821011 TATGTTTTGTATAAGGTGTAAGG - Intergenic
946186866 2:217985994-217986016 TGTGTTCTGAAGGAGCTGTAAGG - Intronic
946564613 2:220950177-220950199 TGTGTTCTGCAGAAACTGTAAGG - Intergenic
948444441 2:238021095-238021117 TGTGTGCTGTAGCAGGAGAAAGG + Intronic
948511821 2:238472324-238472346 TGTATTTTGTAGATGTTGGATGG + Intergenic
948660847 2:239505693-239505715 TGTCTTCAGTTGCAGGTGGATGG + Intergenic
948919469 2:241055138-241055160 TTTGTGCTGTAGAGGGTAGAAGG + Intronic
1169276525 20:4236845-4236867 AGTGGCCTCTAGAAGGTGGAAGG + Intronic
1169660133 20:7969612-7969634 TGTGTTCTGTAGAAGCAGCCTGG - Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171200319 20:23235489-23235511 TGTGGGCTGTAGAATGGGGAGGG - Intergenic
1171781418 20:29422070-29422092 TGTTTTATGTAGAAGAAGGAGGG - Intergenic
1172001300 20:31779785-31779807 AGTGTTCTTTAAAAGGAGGATGG + Intronic
1173536612 20:43819302-43819324 TGTTTTTTGTATAAGGTGTAAGG - Intergenic
1173852928 20:46230097-46230119 TGACTTCTGAAGAAGGTGGGAGG - Intronic
1174080349 20:47967073-47967095 TTTGCTCTGGACAAGGTGGATGG - Intergenic
1175766691 20:61597456-61597478 TCTGTACTGGGGAAGGTGGAAGG - Intronic
1177470011 21:21548439-21548461 TTTGTTATGTAGACAGTGGAGGG - Intergenic
1177900476 21:26908777-26908799 TGAGTCCTTTAGGAGGTGGAAGG + Intergenic
1178362377 21:31959210-31959232 TGTTTTGTGCAGAAGGAGGAAGG - Intronic
1178592928 21:33926773-33926795 TGAGTTTTGTATAAGGTGTAAGG + Intergenic
1178806449 21:35843681-35843703 AGAGTTCTCTAGAAGATGGATGG - Intronic
1179002440 21:37475311-37475333 TTTTTGCTGTAGAAGGTAGAAGG + Intronic
1181316125 22:21971944-21971966 TGTGCTGTGTGGCAGGTGGAGGG - Exonic
1181743501 22:24939814-24939836 TGTGCCATGAAGAAGGTGGAGGG - Intronic
1181834987 22:25597976-25597998 TGTGTTGGGCAGAAGGTGTATGG + Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
949361787 3:3240311-3240333 ACTGTTCAGAAGAAGGTGGAAGG + Intergenic
950461515 3:13124990-13125012 TGTGGACTGGAGAAGGAGGATGG - Intergenic
953097056 3:39788493-39788515 TGTGCTCTGTAAAATGTGCAAGG + Intergenic
953711867 3:45279098-45279120 TGTATTCTGTAGCAGTTAGATGG - Intergenic
955695316 3:61629947-61629969 TTTGTTCAACAGAAGGTGGATGG + Intronic
957399754 3:79694407-79694429 TGTATGCTGTGAAAGGTGGAAGG + Intronic
957851518 3:85813705-85813727 TGTTTTTTGTATAAGGTGTAGGG + Intronic
959105293 3:102058587-102058609 TGTGTTCAGTATAGAGTGGATGG + Intergenic
959433049 3:106278524-106278546 TGTATTCTGTAGAAGTTGGGAGG + Intergenic
959879532 3:111427773-111427795 TGAGTTTTGTAGATGGTGTAAGG - Intronic
960095995 3:113690513-113690535 TGTGTGTTGTACTAGGTGGAAGG - Intronic
961722351 3:128905325-128905347 TTTGTTTTGTTGAGGGTGGAGGG + Intronic
962924454 3:139978699-139978721 TGTGTTGTGTGGAAGGGAGAGGG + Intronic
963130682 3:141855186-141855208 TGTTTTCAGTATAAGGCGGAGGG - Intergenic
963283694 3:143412403-143412425 GCTGTGCTGTAGAAGGTGCAGGG - Intronic
964068090 3:152600943-152600965 GTTGTTTTGTAGAAGGTGTAGGG - Intergenic
964467182 3:157007255-157007277 TATGGTCTGTAGATGGTGGGTGG - Intronic
965018457 3:163192380-163192402 TGATTTCTGTATAAGGTGTAAGG + Intergenic
965353802 3:167648768-167648790 TGGCTTGTGTAGAAGGCGGAAGG + Intronic
966284749 3:178281420-178281442 TGTGTTCTGCTGCAGTTGGATGG - Intergenic
966830646 3:184005247-184005269 TGTGTACTTTAAAAGATGGATGG - Intronic
967016815 3:185489769-185489791 GGTGTTCTGGAGTAGGGGGAGGG - Exonic
967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG + Intronic
967790227 3:193540556-193540578 TGTGTTTTGTATAAGCTAGAAGG - Intronic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
968052425 3:195664264-195664286 TGTGTCCTGTCTCAGGTGGACGG - Intergenic
970755336 4:19419022-19419044 TGAGTTTTGTATAAGGTGTAAGG - Intergenic
970996143 4:22269225-22269247 CCTGTTCTGGTGAAGGTGGAAGG - Intergenic
971801124 4:31292888-31292910 TGTGTTCTGCAGCAATTGGAAGG + Intergenic
972017761 4:34267317-34267339 TGCATTCTGTAGATGCTGGATGG - Intergenic
972389954 4:38605110-38605132 GGTGTTCTGGAAAGGGTGGAGGG - Intergenic
972890960 4:43555272-43555294 TGTATTCTGCAGCAGTTGGATGG + Intergenic
973641564 4:52908062-52908084 TGAGCTCTGTAGAAGGAAGAGGG - Intronic
975194104 4:71502795-71502817 TGTATTCTGTAGCAGTTGGATGG + Intronic
976408955 4:84690947-84690969 TGTGATCTATGGAAGGTGCAGGG + Intronic
976905616 4:90232447-90232469 TGATTTCTGTATAAGGTGTAAGG - Intronic
978504376 4:109440699-109440721 GGTGTTCTGAAGAAAATGGAAGG - Intronic
978809346 4:112833017-112833039 AGTGATCTGTAGCAGCTGGATGG + Intronic
980660580 4:135853591-135853613 TGTGTAATGTAGAAGATGAAAGG + Intergenic
980660951 4:135856777-135856799 TGTGTAATGTAGAAGATGAAAGG - Intergenic
980701361 4:136435741-136435763 TATGTTCAGTAGAAGTTGTACGG - Intergenic
981333100 4:143535541-143535563 GGTTATCTGTAGAAGGTGGTTGG + Intronic
981391772 4:144199267-144199289 TGAGTTGTGTATAAGGTGTAAGG - Intergenic
982342062 4:154310622-154310644 TGTTTTCTGTAGACTGGGGATGG + Intronic
982580722 4:157176059-157176081 TGATTTCTGTATAAGGTGTAAGG + Intergenic
982625032 4:157755986-157756008 TGATTTCTGTATAAGGTGTAAGG + Intergenic
982902930 4:161029800-161029822 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
983115476 4:163810849-163810871 TCTGCTTTGTGGAAGGTGGATGG - Intronic
983539574 4:168894760-168894782 TGAGTTCTGTGGAAAGTAGAGGG + Intronic
983546275 4:168967692-168967714 TCTGTACTGGAGCAGGTGGATGG + Intronic
983798386 4:171895372-171895394 TGTTTTCTGGAGTAGGGGGAGGG + Intronic
984394628 4:179179988-179180010 TGTATTCTGTAGTTGTTGGATGG + Intergenic
985703817 5:1389273-1389295 GGTGTTCTGTTGAAGGCAGATGG - Intergenic
986648992 5:9945388-9945410 TGATTTCAGTAGAAGGTGCAGGG - Intergenic
986847739 5:11775604-11775626 TGAGTTCTGTAGGAAGGGGAAGG - Intronic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
989600655 5:43197580-43197602 TGTGTTCTGTAGGAGCTCAAGGG - Intronic
989945439 5:50221980-50222002 TGATTTCTGTATAAGGTGTAAGG + Intergenic
991931366 5:71756118-71756140 TGTCTTCTGTAGGATCTGGATGG + Intergenic
994378536 5:99042596-99042618 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
995316413 5:110779612-110779634 TGGCTTTTGTAGAAGGTGTAAGG + Intergenic
996847952 5:127921358-127921380 TGACTTCTTTAGTAGGTGGATGG - Intergenic
997025765 5:130059104-130059126 TATCTTCTGTAAAATGTGGATGG + Intronic
997135138 5:131317512-131317534 TGTGTTTTGGGGGAGGTGGAGGG + Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998392280 5:141795110-141795132 TGAGGTCTGCGGAAGGTGGATGG - Intergenic
999268715 5:150283901-150283923 TCTGTGCTGGAGAAGGTTGAGGG - Intronic
999331718 5:150677989-150678011 GGTGTTCTGCAGAAGGGAGAAGG + Exonic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1002578417 5:180191991-180192013 TGTGTTGTGGAGAAAGTGGGTGG - Intronic
1005887628 6:30108794-30108816 TCTGTGCTGAAGAAGGAGGAAGG + Intronic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1008476788 6:51942001-51942023 GTTGTTTTGTAGAAGGTGGTGGG - Intronic
1009357017 6:62763023-62763045 TGGGTCCTGTGGAAGGTGAATGG + Intergenic
1009434026 6:63597876-63597898 AGTGTTCTGTATAAGGAAGAAGG - Intergenic
1010521660 6:76845654-76845676 TGATTTCTGTATAAGGTGTAAGG + Intergenic
1010586497 6:77662769-77662791 TTTGTTTTGTAGAAGGTGATGGG + Intergenic
1011394843 6:86895527-86895549 TGTGTTCTGCAGTTGTTGGATGG - Intergenic
1012095031 6:94946970-94946992 TGATTTCTGTATAAGGTGTAAGG - Intergenic
1013580838 6:111533057-111533079 TTTATTCTGTATAGGGTGGAGGG - Intergenic
1013681667 6:112530846-112530868 TGGCTTCTGTAGAAATTGGATGG - Intergenic
1015259230 6:131215541-131215563 AGTGTTCTGTATCAGGAGGATGG + Intronic
1015878290 6:137845902-137845924 TGTTTTCTGTATAAGGAGGCTGG + Intergenic
1015878550 6:137847898-137847920 TGTGTTCTGGAGAAAGGTGAGGG - Intergenic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1016902308 6:149114518-149114540 TGTGTTCTGTAAAACATGCAAGG + Intergenic
1018001381 6:159581447-159581469 TGTGTGCTGTAGGAGGGGAACGG + Intergenic
1018104363 6:160468741-160468763 TGTGTTTGGCAGAAGGTAGAAGG - Intergenic
1018183752 6:161246778-161246800 TCTGTTCTGTAAGAAGTGGAAGG - Intronic
1018297080 6:162359867-162359889 TTTGTTCTGTAGAATATTGATGG - Intronic
1019853525 7:3582519-3582541 TGTCTGCTGTGGAGGGTGGAGGG + Intronic
1020509565 7:9036585-9036607 TGTGTTCTGTTTAAGGTTAAAGG + Intergenic
1020650795 7:10873820-10873842 TGTGTTCTGTGAAAGTTTGAAGG - Intergenic
1021235334 7:18136470-18136492 TGATTTTTGTATAAGGTGGAAGG + Intronic
1021866268 7:24961560-24961582 TGTGTCCTCTAAATGGTGGATGG - Intronic
1023024051 7:36035293-36035315 TGGGTTTTGGAGAAGGTGGTGGG - Intergenic
1023868733 7:44251596-44251618 TGTGTGCTGTAGAGGGTGCCAGG - Intronic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024372293 7:48599883-48599905 TGTATTCTGTAGTAGTTGGATGG + Intronic
1025256316 7:57385849-57385871 TGTGACCTGGAGCAGGTGGAGGG - Intergenic
1025572119 7:62587752-62587774 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
1025813224 7:64888593-64888615 TGGGTGGTGGAGAAGGTGGAGGG - Intronic
1028003902 7:85538308-85538330 TCTGTTTTGTATAAGGTGTAAGG + Intergenic
1029011677 7:97268651-97268673 GGTGGTCTTTGGAAGGTGGATGG + Intergenic
1029482699 7:100822784-100822806 TGTGCCCTGGGGAAGGTGGAGGG - Intronic
1029943571 7:104507432-104507454 TGAGTTTTGTATAAGGTGTAAGG - Intronic
1031171747 7:118300384-118300406 TGTGTTCTGTTGCTGCTGGATGG - Intergenic
1032799048 7:135303448-135303470 TGTGTTCTGTAGAGGATGGGAGG - Intergenic
1033761918 7:144444939-144444961 TCTGTTCTGTAGTTGTTGGATGG + Intergenic
1035613636 8:986567-986589 TGTGTTCTGAGGCAAGTGGAAGG + Intergenic
1035954159 8:4057700-4057722 TGATTTCTGTACAAGGTGTAAGG + Intronic
1036217429 8:6892295-6892317 TGGGTTCTGTTGCAAGTGGAGGG + Intergenic
1036454857 8:8897659-8897681 TGTGTGTTCTAGAAGGTGGAGGG - Intergenic
1036603155 8:10281969-10281991 AGTGTTCTTTCGAAGGTGGAGGG + Intronic
1037083782 8:14820518-14820540 TGTGCTCTGTAGCTGTTGGATGG - Intronic
1037146325 8:15577480-15577502 TGTTTTTTGTATAAGGTGTAAGG + Intronic
1037179680 8:15990514-15990536 TGTGTTCTGCAGCAGTTAGATGG + Intergenic
1037980967 8:23253953-23253975 TTTATTCTGTAGATGGTGGGTGG - Intronic
1038316822 8:26491392-26491414 TTTCTGCTGTAGATGGTGGATGG - Intronic
1039389592 8:37167078-37167100 TGTGGTCTGTAAAAGGATGAGGG - Intergenic
1039608888 8:38903545-38903567 TTTGTTCTGCAGAAGTGGGAAGG + Intronic
1039880849 8:41624645-41624667 TGCGTGCTGTAGAAGATGGATGG - Exonic
1040931096 8:52736055-52736077 TGTGTTCAGAATTAGGTGGATGG - Intronic
1041293839 8:56333926-56333948 TAATTTCTGTATAAGGTGGAAGG + Intergenic
1041625209 8:60017669-60017691 TTTGTTGAGAAGAAGGTGGATGG + Intergenic
1041707547 8:60862460-60862482 TGTGTATTATAGAAGGGGGAGGG + Intronic
1042644846 8:70975408-70975430 TGTCTTTTGTATAAGGTGTAAGG + Intergenic
1045412656 8:101934122-101934144 TGAGTTCTGTACTAGGTGCAGGG + Intronic
1045570757 8:103366960-103366982 TGAGTTTTGTATAAGGTGTAAGG + Intergenic
1045572749 8:103386457-103386479 TGAGTTTTGTATAAGGTGTAAGG - Intergenic
1045946080 8:107797822-107797844 TTTGTTTTGTATAAGGTGTAAGG - Intergenic
1050063214 9:1731955-1731977 TGTGTTGTGGAGAGGGGGGATGG - Intergenic
1050691288 9:8229675-8229697 TGTGTTCAGTTGTTGGTGGATGG - Intergenic
1052159978 9:25246108-25246130 TGGGTACTGAAGAAGGTGGAGGG - Intergenic
1054833674 9:69653485-69653507 TGTATTCTGTAGCTGTTGGATGG - Intronic
1055541326 9:77308651-77308673 TGTGCTCTGTGGAATGTGGCTGG + Intronic
1057191996 9:93093642-93093664 TGAGTTCTTGGGAAGGTGGAGGG - Intergenic
1057727958 9:97582166-97582188 TGATTTTTGTAGAAGGTGTAAGG + Intronic
1059990857 9:119864025-119864047 TATGTTCTGTAGTTGTTGGATGG - Intergenic
1060877249 9:127092227-127092249 CGTGTGCTGTGGCAGGTGGAGGG + Intronic
1062399065 9:136364554-136364576 TGCGTCCTGGAGAAGGGGGAAGG + Exonic
1186385421 X:9105706-9105728 TGTATTTTGAAGTAGGTGGATGG - Intronic
1186500027 X:10043779-10043801 TGTGTTCTCTCAAAAGTGGATGG + Intronic
1187592437 X:20733138-20733160 TGTGGTATTTAAAAGGTGGAGGG + Intergenic
1188484111 X:30663671-30663693 TGTGTGATATAGAAGGAGGAAGG + Intronic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1188960566 X:36486584-36486606 TGTTTTCTCTGGAAGGTGGAGGG - Intergenic
1190781002 X:53594729-53594751 TGTATTCTTTAGTAGGTGGGAGG - Intronic
1190841741 X:54151862-54151884 TGTGTACTGAAGAATGTGAAAGG + Intronic
1192662554 X:73057323-73057345 TATGTTTTGTATAAGGTGTAAGG - Intergenic
1192726766 X:73762138-73762160 TGATTTTTGTACAAGGTGGAAGG + Intergenic
1193459298 X:81771630-81771652 TGATTTCTGTATAAGGTGTAAGG - Intergenic
1194442009 X:93944712-93944734 TGAGTTTTGTATAAGGTGTAAGG - Intergenic
1196464712 X:115960268-115960290 TGTGCTCAGGAGAAGGGGGAAGG - Intergenic
1198848302 X:140937340-140937362 TGTGTACTGTAGGAACTGGAAGG - Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1201570724 Y:15411082-15411104 TGATTTCTGTATAAGGTGTAAGG - Intergenic
1201963273 Y:19706114-19706136 TGTGGTCTGTGGAAGGTGTCAGG + Exonic