ID: 1070127158

View in Genome Browser
Species Human (GRCh38)
Location 10:73631811-73631833
Sequence TTATGGGAATGGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 543}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070127158_1070127167 -2 Left 1070127158 10:73631811-73631833 CCTTTTTCCCTCCATTCCCATAA 0: 1
1: 0
2: 3
3: 51
4: 543
Right 1070127167 10:73631832-73631854 AAGGATACTGGATTAACAATGGG 0: 1
1: 0
2: 1
3: 12
4: 141
1070127158_1070127169 0 Left 1070127158 10:73631811-73631833 CCTTTTTCCCTCCATTCCCATAA 0: 1
1: 0
2: 3
3: 51
4: 543
Right 1070127169 10:73631834-73631856 GGATACTGGATTAACAATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 82
1070127158_1070127168 -1 Left 1070127158 10:73631811-73631833 CCTTTTTCCCTCCATTCCCATAA 0: 1
1: 0
2: 3
3: 51
4: 543
Right 1070127168 10:73631833-73631855 AGGATACTGGATTAACAATGGGG 0: 1
1: 0
2: 2
3: 13
4: 151
1070127158_1070127166 -3 Left 1070127158 10:73631811-73631833 CCTTTTTCCCTCCATTCCCATAA 0: 1
1: 0
2: 3
3: 51
4: 543
Right 1070127166 10:73631831-73631853 TAAGGATACTGGATTAACAATGG 0: 1
1: 0
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070127158 Original CRISPR TTATGGGAATGGAGGGAAAA AGG (reversed) Exonic
901093943 1:6663449-6663471 TTATGGGTATTAAGGAAAAAAGG + Intronic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901201335 1:7469062-7469084 TTCTGGGAACTGAGGGAGAATGG - Intronic
901450065 1:9330651-9330673 GTTTGGGAAGGGAGAGAAAAAGG - Intronic
903413196 1:23163753-23163775 GTATGGGAGTGGAGGGTCAAGGG - Intronic
904226998 1:29029945-29029967 TCAGGGGTATGGAGAGAAAAAGG + Intronic
904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG + Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
906708867 1:47914644-47914666 ATTTGGCAATGGAGGGAAAGAGG - Intronic
907113804 1:51950896-51950918 CCATGGGAATGGAAGGAAACTGG + Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
909423766 1:75496987-75497009 TTATGAGAATGTGAGGAAAAGGG + Intronic
909521780 1:76576816-76576838 TCATGGGAATGGAGAAGAAATGG - Intronic
909574858 1:77162445-77162467 TTGGGAGAATGGAGGGAAATTGG + Intronic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
910223178 1:84909718-84909740 TCATGTGACTGGAGAGAAAAAGG + Intergenic
910377400 1:86587527-86587549 CAATGGGAAGGGAAGGAAAATGG - Intergenic
910450834 1:87343009-87343031 TTCTGCGAATAGAAGGAAAATGG - Intronic
911013076 1:93302388-93302410 TTATCGGAGTGACGGGAAAATGG - Intergenic
911299905 1:96159135-96159157 CTATGAAAATGGAGGAAAAATGG + Intergenic
911860450 1:102941157-102941179 TTAAGGGAAGTGAGGGAAAGTGG - Intronic
911941250 1:104050792-104050814 TTATGAGAATGCAGAGAAATTGG + Intergenic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
913672748 1:121112985-121113007 TTATGTGAATGGAGAGTGAAAGG - Intergenic
914024524 1:143900357-143900379 TTATGTGAATGGAGAGTGAAAGG - Intergenic
914663009 1:149808380-149808402 TTATGTGAATGGAGAGTGAAAGG - Intronic
915324347 1:155073153-155073175 TTATGGGAACACAGGGAAAACGG + Intergenic
915365152 1:155310996-155311018 TCAGGGGAATGAAGGGAAAGGGG + Intronic
915452160 1:156013549-156013571 ATAATGGAGTGGAGGGAAAAGGG + Intronic
916478513 1:165193403-165193425 GAATGGGAATGGAGATAAAAGGG - Intergenic
916655239 1:166869498-166869520 TTGTGAGAATGGACTGAAAAAGG + Exonic
917841530 1:178983870-178983892 TGATGAGAATGCAGAGAAAAGGG + Intergenic
918453559 1:184684599-184684621 TTATGGGAACAGAGGTAAAGAGG - Intergenic
918629451 1:186698885-186698907 TAAATGTAATGGAGGGAAAATGG + Intergenic
918805821 1:189042441-189042463 TTGTGAGAATGCAGAGAAAAGGG - Intergenic
918849964 1:189675209-189675231 TCATAGGATTGAAGGGAAAAGGG + Intergenic
919548359 1:198951673-198951695 TTTGGGGAATGGAGGGTAGAGGG - Intergenic
919881454 1:201903772-201903794 TTTTGGGAAAGGAAGGAAGAGGG - Intronic
920308336 1:205032947-205032969 TTAGGGAAATGCAGGGAAAGTGG + Intergenic
920607759 1:207406718-207406740 TGATGGGAATAGAGTGAAATGGG - Intergenic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
922963119 1:229664950-229664972 TTAGGGGAAGGGAGAGAAAAAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924099354 1:240587906-240587928 GTAAGGGACTGGAGGGAATAGGG - Intronic
1063459337 10:6205283-6205305 TTACTGGAATGGAGGGAAGAAGG + Intronic
1063888425 10:10603517-10603539 TTAGGAGAGTGGAGAGAAAAGGG + Intergenic
1064646441 10:17464702-17464724 TTTGGGGAATGGAGGGGAAGTGG - Intergenic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065324242 10:24536708-24536730 TGAGGAGAATGGAGGGAAACAGG - Intronic
1065359304 10:24874220-24874242 TTATGGGAATTGATGTCAAAAGG + Intronic
1068020483 10:51576575-51576597 TAATGGGAATAGTGGGACAAAGG + Intronic
1068350159 10:55832993-55833015 TGATGAGACTGAAGGGAAAAGGG + Intergenic
1068643886 10:59443985-59444007 TAGTGGGAATGTGGGGAAAAGGG + Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070931452 10:80263972-80263994 CTCTGGGAATGGAGGGGAAGAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1072554070 10:96501366-96501388 GAATGGGAAGGGAGGGAAAGTGG - Intronic
1073821987 10:107274599-107274621 TTTGGGGAATGGAGCGAGAAAGG + Intergenic
1073929882 10:108563517-108563539 TGATGGGAAAAGAGGGAAAGAGG - Intergenic
1074006459 10:109430010-109430032 TGATGGGAAGGCAGGGAGAATGG + Intergenic
1075135215 10:119778596-119778618 TGAGGAGAATGGAGGGAAAATGG - Intronic
1075148053 10:119900026-119900048 TGAGGGGAAGGGAGGGAAGAGGG - Intronic
1076305142 10:129461017-129461039 ATATGGGAATGAAGGGGAAGGGG - Intergenic
1077792064 11:5451697-5451719 TGATGGGAATGAAGGAGAAAGGG - Intronic
1078885360 11:15494518-15494540 TAAAGGAAATGGAGGGAAAGTGG + Intergenic
1079236397 11:18693732-18693754 TTAAGAGAATGGTGGAAAAAAGG - Intronic
1079326644 11:19498534-19498556 TTATGGGGGTGGATGGGAAAAGG - Intronic
1079399652 11:20095921-20095943 TCAAGGGAATGGAAGGACAATGG + Intronic
1080300553 11:30779962-30779984 TTAGGGGAATGTTGGGAATATGG - Intergenic
1080551682 11:33377904-33377926 TTAAGTGAATCGAAGGAAAATGG - Intergenic
1080756122 11:35200932-35200954 GCATGGAAATGGAGGGAAAGCGG - Intronic
1081192412 11:40119988-40120010 TTATGGGAAGGCAGGGTAAATGG - Intronic
1081199175 11:40195557-40195579 TTATTGAAATGAGGGGAAAAGGG + Intronic
1081272285 11:41099599-41099621 TTATGTCAATAGAGGCAAAAAGG + Intronic
1081454233 11:43205639-43205661 TTATGGGCATCCAGAGAAAAAGG - Intergenic
1081461510 11:43276609-43276631 TCAGGGGAAGGGAGGGAAAGGGG - Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1083143147 11:60738167-60738189 TTATGGGGATGAAGAGAGAAAGG - Intronic
1083155433 11:60820106-60820128 TGTGGGGAATGGAGGTAAAAGGG - Intergenic
1083392174 11:62360816-62360838 TTACAGGAATTGAGGGAAAGAGG + Intronic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1085653137 11:78286746-78286768 TTATCAGAATGAAGGGAACAAGG - Intronic
1085928828 11:81056046-81056068 TTAACGAAAAGGAGGGAAAAGGG - Intergenic
1085933922 11:81121577-81121599 TCATGGAAAAGGGGGGAAAACGG - Intergenic
1086480490 11:87231774-87231796 ATATGGAAATAGGGGGAAAAAGG + Intronic
1086487734 11:87326537-87326559 TTATGGGATTGGATGCCAAAAGG + Intergenic
1086677391 11:89625508-89625530 TTAATTGAATGGAGGTAAAAGGG + Intergenic
1087500151 11:98941289-98941311 TTATGAGAAAGGAAAGAAAAAGG + Intergenic
1087582166 11:100071219-100071241 TTTTGGGAAGTGAGTGAAAATGG + Intronic
1088430921 11:109757862-109757884 TTGGGAGAATGGAAGGAAAATGG - Intergenic
1088712008 11:112516857-112516879 TCATGGGAATGGAAGGTGAAGGG - Intergenic
1089328288 11:117672386-117672408 TTTGGGGAGTGGGGGGAAAATGG - Intronic
1089493069 11:118895604-118895626 TTATGGGAAGGGAGTGAGGAGGG - Exonic
1089646338 11:119882282-119882304 TTTTGTGAATGGTGGGAAATAGG + Intergenic
1090153083 11:124405432-124405454 TTATGGGTTTGGAAGGAAATCGG + Intergenic
1090643625 11:128749795-128749817 TAAAGGGCAGGGAGGGAAAAGGG - Intronic
1091062318 11:132474965-132474987 TAATGGTAATGGAGAGAACATGG - Intronic
1091595580 12:1876686-1876708 GCATGGGAAAGGAGGGAAAGAGG - Intronic
1091736557 12:2927025-2927047 TGAGGGGATTGGAGGGAAATGGG - Intronic
1092024053 12:5226034-5226056 GTATGGGAATCCAGGAAAAATGG - Intergenic
1092985616 12:13842736-13842758 TTATGGAAATAGGGTGAAAATGG + Intronic
1093505956 12:19865943-19865965 TTATTGTAAAGGAGTGAAAAGGG + Intergenic
1093704068 12:22255218-22255240 TTATGGGAGGGGTGGGGAAAAGG + Intronic
1093728128 12:22539432-22539454 TTAGGGGAAGGGAGAGAAACAGG - Intronic
1093761097 12:22912003-22912025 TTATAGAAGTGGAGAGAAAATGG + Intergenic
1094050483 12:26215239-26215261 TTGTGGGAATAGAGGAAGAATGG - Intronic
1094120802 12:26972252-26972274 TGATGAGAATGGAGTCAAAAAGG - Intergenic
1094456110 12:30635172-30635194 ATATGGGAATGTTGGTAAAAGGG + Intronic
1095054044 12:37579562-37579584 TTAGGGGAGTTGGGGGAAAATGG + Intergenic
1095252775 12:39998368-39998390 TTTGGGGACTTGAGGGAAAAGGG + Intronic
1096447430 12:51706309-51706331 TGAAGGGAAAGGAGGAAAAAAGG - Intronic
1097038163 12:56137711-56137733 TTTTGGGATTGGGGGAAAAATGG - Intronic
1097446901 12:59682690-59682712 TCAGGTAAATGGAGGGAAAATGG + Intronic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1099140649 12:78970100-78970122 TGATGGAAATTGAGAGAAAAAGG + Intronic
1099568788 12:84286244-84286266 ATAAGGGAATGGAGAGAAATAGG - Intergenic
1099603538 12:84772113-84772135 GTATGGCAATGGATGAAAAAAGG - Intergenic
1099724922 12:86413174-86413196 GAATAAGAATGGAGGGAAAATGG + Intronic
1100062537 12:90599267-90599289 TTATGGGAATGCAAAGAAAGTGG + Intergenic
1100366758 12:93928592-93928614 ATATGGGAATGGAAGCAAAGAGG + Intergenic
1100988253 12:100225576-100225598 TGATGTCAATGGAGGTAAAAAGG + Intronic
1101225353 12:102682694-102682716 TTATAGGAATCTAGGGAAATGGG - Intergenic
1101382501 12:104226377-104226399 TTATGGAAATGAAGTGATAAAGG - Intronic
1101745656 12:107539460-107539482 ACATGAGAATGGAGAGAAAAAGG + Intronic
1101861802 12:108488522-108488544 TGATGGGGCTGCAGGGAAAAGGG + Intergenic
1102795735 12:115687489-115687511 TGATGGCCAAGGAGGGAAAATGG - Intergenic
1103014257 12:117481767-117481789 TTATAGGAGTGGAGAGAGAAGGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103417458 12:120752593-120752615 TCATGGGGATGGAGGGAGAAGGG + Intergenic
1103727208 12:123003910-123003932 TTTTGGGACTAGTGGGAAAATGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105565232 13:21539017-21539039 TTAGGGGAGTGGACGGAAAGAGG - Intronic
1107124265 13:36829281-36829303 TAATGGGAAAGGAGGGAAATGGG + Intergenic
1107417467 13:40213834-40213856 TTATGGAAGTGGGGGAAAAAGGG - Intergenic
1107531632 13:41287989-41288011 TGATGGGAGTGTTGGGAAAATGG + Intergenic
1107560657 13:41554281-41554303 TTCTGAGAATGAAAGGAAAAAGG - Intergenic
1107596112 13:41964678-41964700 TTATAGAGAGGGAGGGAAAAAGG + Intergenic
1108332318 13:49401080-49401102 TTATAGAAATGGAAGGAATATGG - Intronic
1108514818 13:51191120-51191142 GAATAGGAATGGAGGGAAAGGGG - Intergenic
1109447005 13:62454087-62454109 TTGTGGGCATTGAGGGAAAGGGG - Intergenic
1109567553 13:64137193-64137215 TTGTGTGAATGCAGTGAAAAGGG + Intergenic
1109704358 13:66070590-66070612 TTGTAAAAATGGAGGGAAAATGG + Intergenic
1110470009 13:75848891-75848913 TGGTGTGAATGCAGGGAAAAGGG - Intronic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1112699296 13:101986818-101986840 TTATTGGAATCTAGTGAAAAGGG - Intronic
1113174523 13:107546868-107546890 TTATGGTATTGGAGGAAATATGG + Intronic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1114197969 14:20495671-20495693 GGAGGGGAAGGGAGGGAAAAGGG - Intergenic
1114646404 14:24258885-24258907 CTAAGGGAAAGGAGGGAGAAGGG - Intronic
1115288507 14:31744114-31744136 TAATAGGAATGAAGTGAAAATGG + Intronic
1115720048 14:36150661-36150683 TTCTAAGAAAGGAGGGAAAATGG - Intergenic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1116246500 14:42421153-42421175 TGAGGGGAAGGTAGGGAAAATGG - Intergenic
1116756500 14:48955194-48955216 TTCTGAGATTAGAGGGAAAATGG + Intergenic
1117236141 14:53778154-53778176 TGATGGGTATGCAGAGAAAATGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1118604108 14:67490596-67490618 TTATAGGAAAGGAGAGAAAATGG - Intronic
1118833937 14:69462522-69462544 TTTAGGGAAGGGAGGGAGAAAGG + Intergenic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1119698896 14:76736763-76736785 TGATGAGAATGCAGAGAAAAGGG - Intergenic
1120252328 14:82073477-82073499 TTCTGGGCATGGAGCAAAAAAGG - Intergenic
1121420296 14:93808305-93808327 TTATGAGAATGGATGGGACAAGG + Intergenic
1121857511 14:97283683-97283705 TTACGGGAAAGGAGGGAGAAGGG - Intergenic
1122547515 14:102532253-102532275 TTCTGGGAATGCAGATAAAATGG - Intergenic
1122841982 14:104470091-104470113 TTCAGGGAATGGATGGACAATGG + Intergenic
1125797889 15:42417359-42417381 TCCTAGGAATGAAGGGAAAAGGG + Exonic
1126330987 15:47531353-47531375 TTATGCATATGGAGGCAAAAGGG - Intronic
1126381953 15:48057901-48057923 TTATTCAAAGGGAGGGAAAATGG - Intergenic
1126458133 15:48886840-48886862 TTATGGGAATGAGAGGAGAAGGG + Intronic
1127013279 15:54653876-54653898 TAATGGGAAAGAAGGGAAGAAGG - Intergenic
1127178834 15:56392729-56392751 TTATGGTAAGGGAAGGTAAATGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127842687 15:62844646-62844668 TCATGGGAATGGGAGGAAGATGG + Intergenic
1127919469 15:63481983-63482005 GCAGGGGGATGGAGGGAAAAGGG - Intergenic
1128427381 15:67555623-67555645 TGATGGGGTTGGAGGGAAATGGG - Intronic
1128640970 15:69337054-69337076 CTATTGGAATAGAGGAAAAAAGG + Intronic
1129094786 15:73194270-73194292 TTATGGCAATGGAGAGAGAGAGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1131732029 15:95292121-95292143 ATATGGAAAAGGAGGGAAAAAGG - Intergenic
1132394783 15:101464654-101464676 TGCTGGGAATGCAGGGAAATGGG + Intronic
1132630406 16:914568-914590 TCATGGGAAGGGAGGGAAAGAGG - Intronic
1133013021 16:2925329-2925351 GTATGGGAATGGATGGACGATGG - Intronic
1133559460 16:6937288-6937310 ATGTGGGAATGAAGGTAAAAAGG - Intronic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1135353337 16:21749025-21749047 TCATGGGAATAGTGGGAAGAAGG + Intronic
1135451824 16:22565148-22565170 TCATGGGAATAGTGGGAAGAAGG + Intergenic
1135527480 16:23225112-23225134 AAATGTGAATGGAAGGAAAATGG - Intergenic
1135991468 16:27221271-27221293 TTATGGGAAGGAAGGGCAAAAGG - Intronic
1136128229 16:28200952-28200974 TAATGGGAAGGGAAGGAAATGGG - Intronic
1136640616 16:31561871-31561893 TGATGAGAATGTAGGGGAAATGG + Intergenic
1136664346 16:31795423-31795445 TGATGAGAATGCAGGGGAAATGG - Intergenic
1137343679 16:47635450-47635472 TTATGGGGTTTGAAGGAAAAAGG + Intronic
1137785391 16:51134014-51134036 TTTTGGAAATGGATGGAAAGGGG + Intergenic
1138234642 16:55371594-55371616 TTAGGGCATTGGGGGGAAAATGG + Intergenic
1138684319 16:58711387-58711409 CCATGGGAATGGAGTGGAAAGGG - Intronic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139907673 16:70377966-70377988 CTATGGGAAAGGAATGAAAAAGG + Exonic
1140104162 16:71944013-71944035 TTTTGGGTATGGAGAGGAAATGG - Exonic
1141355211 16:83339108-83339130 TGAGGGGGATGGAGAGAAAAGGG + Intronic
1142481749 17:223256-223278 TTATGCGAATTGATGGAAAGAGG - Intronic
1142709090 17:1714016-1714038 TAAGGGAAAGGGAGGGAAAATGG + Intergenic
1143157290 17:4846035-4846057 TCATGGGGAAGGAGGAAAAAGGG + Intronic
1143451141 17:7037396-7037418 TAATGGGACTGGAGTGTAAAAGG + Intronic
1143527602 17:7481573-7481595 TTTTAGGAAAGGAGGGGAAATGG - Intronic
1143801370 17:9384929-9384951 TTTTTGGTATGGAGAGAAAAGGG - Intronic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1146618857 17:34380456-34380478 TTTTGGGACAAGAGGGAAAAGGG - Intergenic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1148039058 17:44691618-44691640 TAAAGGGACTGGAGGGAAAAAGG + Intergenic
1150293374 17:63994327-63994349 AGATGGAAATGGAGAGAAAAGGG - Intergenic
1150296548 17:64011774-64011796 TGATGAGAATGTAGAGAAAAAGG + Intronic
1150500682 17:65648132-65648154 TGATGGGAATGGAGAGAGGATGG - Intronic
1150784080 17:68148968-68148990 TAAAGGGAGTGAAGGGAAAATGG + Intergenic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151991068 17:77574650-77574672 TAATGGGAATGATGGGAAGAAGG - Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154046931 18:10915052-10915074 TTATTAGAGAGGAGGGAAAATGG - Intronic
1154174731 18:12077976-12077998 TTATTAGAGAGGAGGGAAAATGG + Intergenic
1154240231 18:12646692-12646714 TTAAGGGATGGGAGAGAAAATGG + Intronic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156997282 18:43482958-43482980 TTATGGGTCTGTAGGGAAACAGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157781376 18:50442588-50442610 TAATGGGAATGGGAGGTAAATGG + Intergenic
1158162901 18:54506530-54506552 TTCTGGGAATCGAGGCAACAAGG - Intergenic
1158438444 18:57451702-57451724 TGATTGGATTGGAGGGTAAAGGG + Intronic
1158626777 18:59078437-59078459 TGGTGGGAATGGAGGGATCAGGG + Intergenic
1159107274 18:64016753-64016775 TTATGGGTATGGAAGACAAATGG + Intergenic
1159331631 18:67002098-67002120 TGATTGAAATGTAGGGAAAATGG - Intergenic
1159568236 18:70081158-70081180 TTTGGGGACTTGAGGGAAAAGGG + Intronic
1159853393 18:73555009-73555031 TTCTAGAAATTGAGGGAAAAGGG + Intergenic
1160214301 18:76914108-76914130 TTCTGGGCATTGAGGGGAAATGG - Intronic
1162158464 19:8695735-8695757 TTAATGGAATGGAGGGAGATGGG + Intergenic
1162329725 19:10020443-10020465 TTTAGAGAATGGAGGGAAATAGG + Intronic
1162753684 19:12844300-12844322 CTATGGGCATGGATAGAAAAGGG - Intronic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165283568 19:34818023-34818045 TTTTGGGCCTGGAGGAAAAAAGG + Intergenic
1166404966 19:42513821-42513843 ATATGGGAAAGGGGGAAAAAAGG - Intronic
1167246712 19:48377341-48377363 TTAAGGGAATAGTGGGAACAGGG + Intergenic
1167269908 19:48500882-48500904 TGAGGGGTATGGAGGGCAAACGG + Intronic
1167777985 19:51573788-51573810 TTATGAGAACAGAGGAAAAACGG - Intronic
1168275766 19:55277499-55277521 TTATGGCAATGGAGGCGAACAGG + Intronic
1168500941 19:56892641-56892663 ATATGAGAATGTAGGGAAATTGG + Intergenic
925294248 2:2767244-2767266 TAATCAGAATGGAGGGAAACAGG - Intergenic
925431053 2:3793577-3793599 TTGTATGAATGGAGGGGAAATGG + Intronic
926149201 2:10415371-10415393 TTATGGGAAGGGAGGGATGGGGG - Intronic
926555854 2:14357003-14357025 TTTTGGGAAGGAAGTGAAAAGGG - Intergenic
926997147 2:18748265-18748287 ATATAGTAATGGAGGGAAAAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927332341 2:21880294-21880316 TTGTGGGAATGTAGGAAATATGG - Intergenic
927495870 2:23551403-23551425 ACATGGGAAGGGAGGGAAATGGG + Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
928176422 2:29037115-29037137 TGATGGGCAGGGAGGGAAAGTGG + Intronic
929524281 2:42685845-42685867 TTATAAGTATGGAGGGAAAGAGG - Intronic
929566009 2:42985433-42985455 TCATGGGAGTGCAGTGAAAATGG + Intergenic
929826230 2:45311192-45311214 TGAGGGGACTCGAGGGAAAATGG - Intergenic
930870465 2:56165909-56165931 TTATGGGAAGAGAAGGGAAAAGG - Intergenic
931592116 2:63895942-63895964 TTATGGGAATAAAAGTAAAAGGG + Intronic
931823053 2:65971810-65971832 TTTAGGGAATTGAGGGAGAAGGG + Intergenic
931836998 2:66109478-66109500 TCTTTGGACTGGAGGGAAAATGG + Intergenic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
932803210 2:74761201-74761223 TTATGGGGAAGGAGGCAAAGAGG + Intergenic
933366989 2:81365406-81365428 TTATATGAATTGAGGGATAATGG + Intergenic
933413393 2:81952766-81952788 GTTTGGAAATGGAGGGAAAGAGG + Intergenic
933543681 2:83681499-83681521 TTAGTGGAGTGAAGGGAAAAAGG - Intergenic
934033925 2:88072536-88072558 ATTTCAGAATGGAGGGAAAATGG + Intronic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
935284479 2:101551902-101551924 TGATGGTAATGGAGGTTAAATGG + Intergenic
935692020 2:105740586-105740608 TTCTGGGAATGGAGGGACCAAGG + Intergenic
936315352 2:111420101-111420123 TTGAGGAAATGGGGGGAAAAGGG - Intergenic
936344473 2:111664734-111664756 ATATGCCAATGGAGGGAAAATGG + Intergenic
936598144 2:113868968-113868990 TATTGGGAATGGAGGGCAAGTGG + Intergenic
936666085 2:114597265-114597287 ATAGGGGAATGGTGGGAATAAGG + Intronic
936975447 2:118216472-118216494 TGATGAGAATGCAGAGAAAATGG + Intergenic
937139008 2:119582202-119582224 CCATGGGAATGGAAGGAGAATGG + Intronic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
939036717 2:137140787-137140809 TGATGGGAAGGGAGATAAAATGG + Intronic
939277457 2:140017439-140017461 TTATGAGAATGAATTGAAAATGG + Intergenic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
940624388 2:156154230-156154252 TGATGCTAATGTAGGGAAAAGGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940768132 2:157811566-157811588 AAATGGGAATGGAGGAAATAAGG - Intronic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
941063317 2:160872569-160872591 TCATGGGATAGGAGGGAAAGAGG + Intergenic
941102292 2:161309382-161309404 TTATGGAAAGGCAGGGGAAAGGG + Intronic
941712746 2:168731596-168731618 CCATGGGAAGGGAGGGACAAAGG + Intronic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942578247 2:177389171-177389193 TTTTGGGAATGGTAAGAAAAAGG - Intronic
943278118 2:185894994-185895016 TTATGGGAATGAGAGGAAATGGG + Intergenic
943344057 2:186716367-186716389 TTCTGGGTAAGGAAGGAAAAGGG - Intronic
943956393 2:194196895-194196917 TTTTGGGAAAGGAGGGGCAAGGG + Intergenic
944282187 2:197910688-197910710 TTAAGGGAATTGAGGGGAAAGGG - Intronic
944996185 2:205296722-205296744 TTTTGGGAATGGAGGGTAGTAGG + Intronic
945273010 2:207960642-207960664 TAATGGGAGTGGAGAGGAAAGGG + Intronic
946014800 2:216595284-216595306 TGATGCCCATGGAGGGAAAAGGG - Intergenic
946025032 2:216666509-216666531 TAAGGGTAATGGAGGGGAAATGG - Intergenic
947280569 2:228448470-228448492 CTATGGGAAAGGAGGGCTAAAGG - Intergenic
947304876 2:228734467-228734489 TAGGGGGAATGGAGGGGAAATGG - Intergenic
947807872 2:232981061-232981083 CTAGGGGAATGGAGGGGTAAGGG + Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948464439 2:238145492-238145514 TTATGGGGATGGAGGGACCTGGG + Intronic
1169545141 20:6642296-6642318 TTTTCAGAATGGAGGGAAAAGGG + Intergenic
1169546303 20:6654485-6654507 TTATGGGAGGGGAGGAGAAAGGG - Intergenic
1169705821 20:8503544-8503566 TAATAGGAAGGGAAGGAAAAAGG - Intronic
1169773479 20:9226632-9226654 CTATAGGAAAGGAAGGAAAATGG - Intronic
1170383831 20:15794541-15794563 TTAGGGGAAAGGAGAAAAAATGG - Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172430394 20:34885918-34885940 TTATGGATATGGGGGTAAAAAGG + Intronic
1172780826 20:37436186-37436208 TGATGGGGATGGATGGATAATGG - Intergenic
1173293437 20:41734470-41734492 TCTTGGGAATGGAGGGCTAAAGG + Intergenic
1173311540 20:41900624-41900646 TGATGAGAATGGAAGGAAAGGGG + Intergenic
1175661197 20:60814027-60814049 TTAACAGAATGAAGGGAAAAAGG + Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1176688020 21:9871596-9871618 TTCTGGAAGTGGAGGGACAAGGG - Intergenic
1178390981 21:32198197-32198219 ATATGGGAAGGGAAGGAAAGAGG + Intergenic
1178498300 21:33105226-33105248 TTATGGAAATGGAGGGACCCAGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181087158 22:20446255-20446277 ATATGTGTATGGGGGGAAAAGGG + Intronic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181663014 22:24367255-24367277 TTATGTGAATGGATGCAAAAAGG - Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1181893186 22:26082929-26082951 AGATGGGAGTGGAGGGCAAATGG - Intergenic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182067705 22:27442357-27442379 TGCTGGGAATGGGGGGGAAAGGG - Intergenic
1182081412 22:27531698-27531720 AGCTGGGAGTGGAGGGAAAAGGG + Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184919658 22:47596822-47596844 TCATGGGAGAGGAGGGAAGAGGG - Intergenic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185007662 22:48291927-48291949 TGATAGGAATGGAGGTAAATTGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949124526 3:430873-430895 TTCTAGAAATGGAGGGAAAATGG - Intergenic
949481181 3:4494732-4494754 TTATGAGAGAGGAGGGGAAAAGG + Intronic
949789740 3:7779939-7779961 TGGTGAGAATGGAAGGAAAAAGG - Intergenic
949815179 3:8050528-8050550 TTATGGGACTCAATGGAAAATGG - Intergenic
951692045 3:25406719-25406741 TAATGGGAATGAAGGGAGAAAGG + Intronic
951752545 3:26053703-26053725 TTTTGGTGATGAAGGGAAAAAGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952062683 3:29529341-29529363 TTATGGCCATGGGGGCAAAAAGG + Intronic
952120830 3:30242289-30242311 TTCTGGGAACAGAAGGAAAAGGG - Intergenic
952144860 3:30521087-30521109 TGAAGGGAAAGAAGGGAAAAGGG - Intergenic
952515999 3:34105215-34105237 TGATGGGAGTGAAGGGAGAAGGG - Intergenic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
954171062 3:48802764-48802786 TTAAAGGTATGGAGAGAAAAAGG + Intronic
955278024 3:57566597-57566619 TAATGAGGATGGAGGGAAACTGG - Exonic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955956335 3:64293641-64293663 ACAGGGAAATGGAGGGAAAATGG - Intronic
956127331 3:66023231-66023253 ATATGGAAATGGAGGGGGAAAGG + Intronic
957086213 3:75680253-75680275 TGATGTGAATGTAGTGAAAAGGG - Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
958912196 3:100006388-100006410 TTATGGGGAAGGAGGAAAAAAGG - Intronic
959255166 3:104001225-104001247 TTATGGGAAGGGAAAGTAAAGGG + Intergenic
960203780 3:114870429-114870451 ATATGGGATTGGAGGGAGAATGG - Intronic
960616324 3:119599321-119599343 TGATGGAAGTGGAGGGAACAGGG + Intronic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
961237548 3:125380577-125380599 AGATAGTAATGGAGGGAAAATGG - Intergenic
962031928 3:131610105-131610127 ATTTGTGAAAGGAGGGAAAAAGG - Intronic
962369201 3:134806669-134806691 TTAGGGGAAGGGTGGGAAAGGGG + Intronic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
962670766 3:137706443-137706465 TTATGGAAATGCAAAGAAAAAGG - Intergenic
962865910 3:139447974-139447996 AGATGGGAAAGGAGGGGAAAGGG - Intergenic
962960319 3:140305345-140305367 TAATGGGAATGGAGTTTAAAGGG - Intronic
963333361 3:143941992-143942014 TTATTAGAATGTGGGGAAAAGGG + Intergenic
963402818 3:144822893-144822915 TTATGAGAATTGAAGGAAACTGG + Intergenic
963550097 3:146709380-146709402 GTATGGGAAGGGAGGGAGGAAGG - Intergenic
964014107 3:151925747-151925769 TTATAGGAAGGGAGGGAGAGAGG - Intergenic
964302267 3:155301772-155301794 TTAAAGGAATTGAGGGAGAAAGG - Intergenic
965110967 3:164421660-164421682 TTTTGGGGGTGGAGGGTAAAGGG - Intergenic
965478947 3:169192600-169192622 TTATGTGATTGGAAGGAATATGG - Intronic
966462816 3:180196488-180196510 TAATGGCAATGGTGGGAAGAGGG - Intergenic
966591478 3:181688294-181688316 GTATGGGAAAGGAGAGAAATGGG + Intergenic
966656568 3:182364958-182364980 TCATGCGATTGGAGAGAAAAGGG + Intergenic
967432407 3:189402141-189402163 ATATGGGATGGGAGGGGAAAGGG + Intergenic
968434302 4:576715-576737 TTATGGGGATGCAGGGAGAGGGG + Intergenic
969167699 4:5331067-5331089 CTATGGGAGTGGAGGGGAAGGGG - Intronic
969580439 4:8061472-8061494 TTAGGGGAGTGGGGTGAAAAAGG + Intronic
969695866 4:8734536-8734558 TGATGAGGATGGAGGAAAAAGGG - Intergenic
970191293 4:13522184-13522206 TTAAGCTAAAGGAGGGAAAAGGG + Intergenic
970327083 4:14936990-14937012 TTCTGGGAGTTGAGTGAAAAAGG - Intergenic
970429896 4:15978973-15978995 TTATTGGAAGGAAGGAAAAAAGG + Intronic
970725231 4:19036233-19036255 TTATAGAGATGGATGGAAAAGGG - Intergenic
971256181 4:25015675-25015697 AAATGAGGATGGAGGGAAAATGG - Intronic
971507943 4:27386710-27386732 ATATTGGAATGGAGTTAAAAAGG - Intergenic
971585550 4:28401819-28401841 TTCTGGCAAGGGAGAGAAAAGGG + Intronic
971655664 4:29341029-29341051 TGATGAGAATGTAGAGAAAAGGG - Intergenic
972511108 4:39769777-39769799 GTATGTGGAGGGAGGGAAAAGGG - Intronic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972669927 4:41205389-41205411 TTTTGGGAATGGTGAGAAAATGG - Intronic
973188000 4:47353761-47353783 TTATGGGAATGGAAGGAGATGGG - Intronic
973877939 4:55240509-55240531 TTTTGGGAATGGTGTGAAGAAGG - Intergenic
975277930 4:72524226-72524248 TTATGGGAAGGGAGGAAGACAGG + Intronic
976155718 4:82142650-82142672 TTCTGGGAATGGAAAGAATAAGG + Intergenic
976798589 4:88961992-88962014 TTAGGGAAATGGAGGGAAAGAGG + Intronic
977123894 4:93139652-93139674 TTATTGGAATGGAAGGGTAAGGG - Intronic
977586618 4:98781552-98781574 CTATGGGAATGGATGGGAATTGG + Intergenic
977643412 4:99383458-99383480 TTGTGGAATGGGAGGGAAAAAGG - Intergenic
977795570 4:101160829-101160851 TTTTAGGAATGTAGAGAAAATGG + Intronic
978665045 4:111172434-111172456 TTATAGGTCTGGAGGTAAAAAGG - Intergenic
980045554 4:127984313-127984335 TTATGGGAAAGAAGACAAAAAGG - Intronic
980741714 4:136958405-136958427 TGATGGGAAAGCAGGGAATAAGG - Intergenic
980953768 4:139407902-139407924 TTCTGGGAATGGAGTTACAATGG + Intronic
981165944 4:141557151-141557173 TGATGAGAATGCAGAGAAAAAGG - Intergenic
981282836 4:142979237-142979259 TTATGGGAAAGAATTGAAAAAGG + Intergenic
981360129 4:143836579-143836601 TTATGGGGATGGAGTAAAAGAGG + Intergenic
981370900 4:143957647-143957669 TTATGGGGATGGAGTAAAAGAGG + Intergenic
981421483 4:144555450-144555472 TTTTGGGAATGTATGGAGAAGGG - Intergenic
981445722 4:144836199-144836221 TTGTGGTAATGTAGAGAAAAGGG - Intergenic
981973065 4:150689305-150689327 GTATGGGGATGGAGGGCAAGGGG + Intronic
982364628 4:154562151-154562173 TTGTGGGAAATGAAGGAAAATGG + Intergenic
982422930 4:155218965-155218987 TGATTGGAATGGAGGAAGAAAGG + Intergenic
983239007 4:165209916-165209938 TAATGGGAGTGGAGGCAAACAGG - Exonic
983393679 4:167166648-167166670 TTATGACAATGGAAGGTAAATGG + Intronic
985264835 4:188147885-188147907 TCATGGGATGGGAAGGAAAATGG - Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985824853 5:2184622-2184644 TTATAGGAATGGATGGAAAAGGG + Intergenic
986062435 5:4204234-4204256 TTATTTGGATGTAGGGAAAATGG - Intergenic
986112245 5:4730876-4730898 TCAGGGGAGTGGAAGGAAAAGGG + Intergenic
986355303 5:6918334-6918356 TGATGGGGATGGGGTGAAAAAGG + Intergenic
986609875 5:9556406-9556428 ATATGTCAAGGGAGGGAAAAGGG + Intergenic
987970376 5:24936220-24936242 TTATAGGAATGAAGGAACAAAGG + Intergenic
988394172 5:30675781-30675803 AAATGGGAAGGGAGGGAAAGTGG + Intergenic
988627435 5:32892690-32892712 TCATTGAAATGGAGTGAAAAGGG + Intergenic
988959348 5:36354000-36354022 TGATGGAAAGGGAGGGAGAAAGG + Intergenic
989343983 5:40408559-40408581 TGATGGGGATGGTGGGAAAGGGG - Intergenic
989446209 5:41532455-41532477 TAAAGGGAAAGGGGGGAAAAAGG + Intergenic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990477901 5:56179412-56179434 TTAGAGGAATGAAGGGAAAAGGG + Intronic
990486576 5:56265154-56265176 TTATGGGAATGAAAGGCATATGG + Intergenic
991311176 5:65244227-65244249 TATTGGGAATGGTTGGAAAAAGG + Intronic
991708327 5:69381690-69381712 GTATGGAAAAGGGGGGAAAAAGG + Intronic
992007303 5:72490578-72490600 TGCTGGGCATGGAGGGACAATGG + Intronic
992473756 5:77082694-77082716 TGATGTGAAAGGAGGGAGAAGGG + Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994033729 5:95175038-95175060 TTAAGTAAATTGAGGGAAAAAGG + Intronic
994479226 5:100311757-100311779 TTATGGGAATTGAAAGAGAAAGG + Intergenic
994934700 5:106239111-106239133 GGATGGGAGGGGAGGGAAAAGGG + Intergenic
995441695 5:112199328-112199350 TTCTGGGAATGAAGAGAGAAGGG + Intronic
995640688 5:114253288-114253310 TTATGGAAATGCAGGTCAAATGG + Intergenic
996095471 5:119394272-119394294 TTAGGGGAATGAGGGGCAAAAGG + Intronic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996652200 5:125892629-125892651 CTATGGGAAGGAAAGGAAAAAGG + Intergenic
996855472 5:128001138-128001160 TTCTGGGAATAGAGCCAAAATGG + Intergenic
996898788 5:128519839-128519861 ATATGGCAATAAAGGGAAAAAGG + Intronic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
997850249 5:137326051-137326073 TTATGGAAATAAAGGGAATACGG - Intronic
998025943 5:138816510-138816532 TGGTGGGAATGCAGGGAAAGGGG - Intronic
998549109 5:143059559-143059581 TAATGGGACTGGAGGGGGAAAGG - Intronic
998717242 5:144898396-144898418 TTATGGGAAAGGAAGAAAACTGG + Intergenic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
998937085 5:147240836-147240858 AAATGGGAAGAGAGGGAAAAAGG - Intronic
999486402 5:152001152-152001174 ATATGAGAATGGATGGATAATGG + Intergenic
999595099 5:153194439-153194461 TTATGGGAATTCAGGTGAAAGGG - Intergenic
999620001 5:153463251-153463273 TTCTGGAAATGGAGGGGAAATGG + Intergenic
999917146 5:156275134-156275156 TTATGGGCAAGGAAGGCAAAGGG - Intronic
1000138673 5:158380458-158380480 TTCAGGGAATGGAGGCCAAAGGG + Intergenic
1000192936 5:158929823-158929845 TTATGGGAGTTGCAGGAAAAAGG + Intronic
1000257723 5:159556840-159556862 TTATGTGAAAGGAGAAAAAAAGG - Intergenic
1000429708 5:161136580-161136602 TGCTGGGAAAGGAAGGAAAAAGG - Intergenic
1000700300 5:164441348-164441370 TAAATGGATTGGAGGGAAAAGGG - Intergenic
1000836576 5:166161922-166161944 TTATGGGAATGGTAGGGGAAAGG + Intergenic
1001323503 5:170702093-170702115 TTATGGGACTGGAGAGACATGGG - Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003626895 6:7749396-7749418 AAATAGGAATGAAGGGAAAATGG - Intronic
1003885246 6:10515785-10515807 GTAGGGGTATGGAGGGAAAGGGG - Intronic
1004065715 6:12241941-12241963 TTATGGGAATGCAGTAAAGATGG - Intergenic
1004094419 6:12538625-12538647 TTAAGGGTATGGAGGGCAAAGGG + Intergenic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1004723993 6:18293495-18293517 TAATGGCAAAGGAGTGAAAAGGG + Intergenic
1005152963 6:22773623-22773645 TTATTGGAATGAAGGGTAAGGGG - Intergenic
1005283873 6:24303390-24303412 TTTTGGGAATGGAGGGGAGCAGG - Intronic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005898016 6:30195033-30195055 TCAAGGGAAGGGAGAGAAAATGG - Intronic
1006136548 6:31899633-31899655 ATATGTGGAGGGAGGGAAAAGGG - Exonic
1006415616 6:33902056-33902078 CTCTGGGAATTGGGGGAAAAGGG + Intergenic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1007960174 6:45951643-45951665 TTAGGGAAGAGGAGGGAAAATGG + Intronic
1008046968 6:46860995-46861017 TTATGGAAATGGAGCAAAAAAGG - Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008949188 6:57136571-57136593 TTTGGGGAAGGAAGGGAAAAAGG + Intronic
1009435452 6:63613083-63613105 TGGTGGGAATGGAGAGATAAGGG + Intergenic
1009822298 6:68818550-68818572 TTATTGGAAAGGGGGAAAAAAGG + Intronic
1011005860 6:82644879-82644901 TTATGGGATAGGTGGGAACAGGG + Intergenic
1012069661 6:94597599-94597621 TGAGGGGCATGGAGGGAAAAGGG - Intergenic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1016473844 6:144404721-144404743 TTATGAAAATGGAGAGAAATAGG + Intronic
1017403503 6:154091564-154091586 GGATGAGAATGGAGGGAAGAGGG + Intronic
1017489807 6:154935020-154935042 TTGTTGGAATGTAGGAAAAAGGG + Intronic
1019256412 7:55241-55263 TAATGTGACTGGAGGGAAAGTGG - Intergenic
1019692680 7:2425423-2425445 TTTTGGGGGTGGAGGGTAAAAGG - Intronic
1019924110 7:4181098-4181120 GGATGGGAAAAGAGGGAAAAGGG - Intronic
1020865461 7:13555797-13555819 TTATGAGAAAGGGGGAAAAAAGG + Intergenic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1021042326 7:15877524-15877546 TTGTGGAAATAGAGGGAAAGTGG + Intergenic
1023143579 7:37127363-37127385 TTCTTGGAATGGAGGGAAAGGGG - Intronic
1023553116 7:41389930-41389952 TTATGTGAATTAAGGGGAAATGG - Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025038371 7:55617698-55617720 TTGTGAGAATGCAGAGAAAAGGG - Intergenic
1026852681 7:73734993-73735015 TGCTGGGAAGGGAGGGCAAAGGG + Intergenic
1026919288 7:74143343-74143365 ACATGTGAAAGGAGGGAAAAAGG - Intergenic
1027401838 7:77817199-77817221 TGATGAGAATGCAGAGAAAAAGG - Intronic
1027440637 7:78215704-78215726 CCATGGGAATGGAGGAAAAGGGG + Intronic
1027946572 7:84753577-84753599 TGATGGGAATGTGGAGAAAAAGG + Intergenic
1028621197 7:92831533-92831555 TTGTGATATTGGAGGGAAAAGGG - Intronic
1029053844 7:97719048-97719070 TCATGAGGATGCAGGGAAAAGGG + Intergenic
1030504028 7:110397060-110397082 TGATGGGAACTGGGGGAAAAAGG + Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1033123215 7:138684619-138684641 TTGTGGGAATGTGGAGAAAAAGG + Intronic
1033653308 7:143358076-143358098 TCAAGGGATTGGAAGGAAAAGGG + Intronic
1034009248 7:147509848-147509870 TTCTGGGAATTGAAGGAAAGAGG + Intronic
1034376056 7:150645372-150645394 TAATGGGAACTGAGGGAAATAGG + Intergenic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1034550132 7:151815171-151815193 TTGGGGGAATGGAGTGTAAATGG - Intronic
1036176845 8:6547415-6547437 TTATGGCAGTGGAGTGAAAGGGG - Intronic
1038103607 8:24408496-24408518 ATATGGGAAGGGAGGAAATAGGG + Intergenic
1038268354 8:26053491-26053513 TTATGGCAAAGGAGGCATAAGGG - Intergenic
1039029162 8:33291153-33291175 TTAAGAGAAGGGATGGAAAAAGG - Intergenic
1040506956 8:48057640-48057662 TTCTGGGGAGGGAGGGAAAGGGG + Intronic
1040896367 8:52373159-52373181 TTCTGGGAAAGGAGGGGAAGGGG + Intronic
1041073039 8:54143762-54143784 GTAAGGGAATGGAGGGAGCAGGG - Intronic
1041289169 8:56292613-56292635 TTATGGGAACTGAGGTAAATAGG + Intergenic
1042089526 8:65143754-65143776 TGAAGGGAATGGAGGTATAAAGG - Intergenic
1042314892 8:67415148-67415170 TTAAGGGAAGGGATGGGAAAGGG + Intergenic
1043287761 8:78555927-78555949 TTATGGCACTGGTGGGTAAAGGG + Intronic
1043413402 8:80023889-80023911 TTTTAAAAATGGAGGGAAAATGG + Intronic
1043517380 8:81007198-81007220 TTGTGGGAAGTGCGGGAAAAAGG + Intronic
1043970561 8:86524021-86524043 TAATGTGAATGGAGAGAAAATGG + Intronic
1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG + Intergenic
1044948297 8:97411983-97412005 TTATTTGAAGGGAGAGAAAATGG - Intergenic
1045226510 8:100251777-100251799 TTAGTAGAATGCAGGGAAAAGGG + Intronic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1047056656 8:121172295-121172317 ATAGAGGAAGGGAGGGAAAAAGG + Intergenic
1047402207 8:124556828-124556850 TCCTGGGAATGGAGGGAGAAGGG - Intronic
1047667086 8:127104046-127104068 TCTAGGGAATGGAGGGAGAAGGG + Intergenic
1048762489 8:137810803-137810825 TTCTGGGAATGGAGAGGAAGAGG + Intergenic
1049470825 8:142774353-142774375 TTCTGGGCAGGGAGGGAAAGGGG - Intronic
1049853178 8:144845267-144845289 TCATGGGAATGGTGGGCAAAAGG - Intronic
1050190906 9:3024973-3024995 TTAGGGGAATGGAGGGAGTATGG - Intergenic
1050360804 9:4829290-4829312 TTATGGAGATGGAAGGAGAACGG + Intronic
1050416887 9:5427790-5427812 TTCTGGAAAAGGAGGGACAAGGG + Intronic
1050439684 9:5648648-5648670 TGATGAGAATGCAGAGAAAAGGG - Intronic
1054894124 9:70288025-70288047 TAATAGGAATGGAGTAAAAAGGG - Intronic
1054941265 9:70744781-70744803 TTCTGGGAATAAAGAGAAAATGG + Intronic
1055307682 9:74947151-74947173 TGAGAGGAATGGAGGGAAACAGG + Exonic
1056648907 9:88440889-88440911 GGAGGGGAAGGGAGGGAAAAGGG - Intronic
1058333836 9:103800816-103800838 TGATGGGAATAGTGAGAAAATGG + Intergenic
1058696339 9:107562299-107562321 TAATGGAAATGCAAGGAAAAGGG - Intergenic
1058927815 9:109685147-109685169 TCATAGGAATGGAGTGCAAAGGG + Intronic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1058952325 9:109915433-109915455 TTTAGGGAATGAAGGTAAAAGGG + Intronic
1059565860 9:115382473-115382495 TTATGGGTATCAAGGGAAAGAGG + Intronic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1060018418 9:120107377-120107399 GTTTGGGAATGCAGGGAGAAAGG + Intergenic
1060788611 9:126470134-126470156 TTATGGGAAAGCAGGCAGAAAGG - Intronic
1061150331 9:128824518-128824540 GGTTGGGAATGGAGGCAAAAGGG - Intronic
1061596938 9:131636918-131636940 TTTTTGGAATGAAGGGAACATGG + Intronic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1186469343 X:9809040-9809062 TTGGGGGAAGGGAGGGAAAGGGG - Intronic
1187565678 X:20447237-20447259 TTTTGGGCATGGACAGAAAAGGG + Intergenic
1188780675 X:34280108-34280130 TTCTGGCAAAGGAGGCAAAAAGG + Intergenic
1189860553 X:45266672-45266694 TTAAGGGAATAGAGGAAACAGGG - Intergenic
1191720262 X:64223172-64223194 TGGTGGGAAGGCAGGGAAAATGG + Intergenic
1191861553 X:65669545-65669567 TCCTGGGAATGGAGAGAGAATGG + Intronic
1193304831 X:79936231-79936253 TTTGGGGAAGGGAGGGAAAAGGG - Intergenic
1195074754 X:101316024-101316046 GTAGGGGAGTGGAGGGGAAATGG - Intergenic
1195365264 X:104118212-104118234 TAATGAGAATGAAGGGAGAAAGG - Intronic
1195703061 X:107719254-107719276 GTATGGGAAGGGAAGGCAAAAGG + Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1197183708 X:123563347-123563369 TTATGGGTCTAGAGGTAAAATGG - Intergenic
1197750777 X:129962109-129962131 TTAGAGGAATGGAGGTAGAAGGG + Intergenic
1198015872 X:132610366-132610388 ATATAGGAATGAAGGGAAGAAGG + Intergenic
1200915073 Y:8564380-8564402 TTTTGGGAATGGAGATAGAAGGG + Intergenic
1200920959 Y:8612489-8612511 TTTTGGGAATGGAGTCAGAAGGG + Intergenic
1200940046 Y:8771721-8771743 TTTTGGGAATGGAGCCAGAAGGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic